? What is Computer Science and what can you do with it.

Slides:



Advertisements
Similar presentations
Unit 21 Body Language.
Advertisements

CVs & Telephone Skills Top Tips to remember …
WELCOME to Kindergarten
School of Computer Science Carnegie Mellon University.
? What is Computer Science and what can you do with it.
School of Computer Science McGill University Copyright © 2002 All Rights Reserved Outreach Roadshow presents the Supported in part by the NSF-ALADDIN.
Department of Mathematics and Computer Science
Penn State Math Club March 31 st, MacArthur Puzzle Directions: Write down the number of the month in which you are born Double it Add 5 Multiply.
School of Computer Science Carnegie Mellon
Welcome to: The School of Computer Science Roadshow Carnegie Mellon
Computer Science Prof. Bill Pugh Dept. of Computer Science.
Careers in Mathematics 24 March Careers In Mathematics What can you do with a B.Sc. degree in Mathematics ? Where do you want to work ?
Introduction to Software Engineering CS-300 Fall 2005 Supreeth Venkataraman.
FACULTY OF COMPUTER SCIENCE & INFORMATION TECHNOLOGY, UNIVERSITY OF MALAYA.
Occupational Career Project By Jimmy Evans. I want to pursue a career in computer engineering. Specifically something in computer software. I think a.
 Do you ever play video games?  What is your favorite video game and why?
Computer Careers Dr. Kip Irvine School of Computing and Information Sciences, Florida International University.
How Do I Find a Job to Apply to?
COMPUTER SCIENCE LYNDA THOMAS – SENIOR LECTURER, ACADEMIC ADVISOR.
2010 QICF. Carnegie Mellon University in Pittsburgh, Pennsylvania, USA Founded by Andrew Carnegie in 1900 The youngest top-25 American research university.
1 CMPE1 Hands-on Computer Engineering Stephen Petersen Richard Hughey.
Computer Science Department Sonoma State University.
Computing For Biology An online course for A-level students Runs 18 th to 29 th August 2014 TCGATTCCAGAACTAGGCATTATAGATAGATTCAG ATAGGACATAGATCGATTCAGATAGGATATAATCG.
School of Computer Science, Carnegie Mellon University.
Communication With Teachers, and Study Habits. COMMUNICATION.
Computer Jobs 2013 Bob Nielson. Average Wage The average wages of all jobs in America >>>> $45,790 > $80,180.
Welcome to Computer Science at Missouri S&T Daniel TauritzDan Lin Associate Professor Assistant Professor Margret A. Steele undergraduate.
Computer Hardware and Software Chapter 1. Overview Brief History of Computers Hardware of a Computer Binary and Hexadecimal Numbers Compiling vs. Interpreting.
Computer Jobs 2014 Bob Nielson. Average Wage The average wages of all jobs in America >>>> $45,790 > $80,180.
Cool Computing News Computing majors are in demand By 2016 there will be more than 1.5 million new high- end computing jobs Five of.
Dahnish Hussain Assignment 1 Information and Creative Technology.
Student Training Presentation. On Wednesday, April 8, all juniors will take the Standards Based Assessment (SBA) in Science. This is part of the testing.
School of Computer Science Carnegie Mellon University
Introduction to Programming Peggy Batchelor.
Introduction to Programming ICS2O Findlay. Learning Goals  We will learn  The definitions of a computer, program and programming language.  The different.
The New Computing Curriculum select, use and combine a variety of software (including internet services) on a range of digital devices to design and create.
6-1 Object-Oriented Design Today we focuses on: –the this reference (Chapter 7) –the static modifier (Chapter 7) –method overloading (Chapter 7)
Program Development Life Cycle (PDLC)
Lecture 5: Using Computers: Important Ideas Tonga Institute of Higher Education IT 141: Information Systems.
Algorithms and their Applications CS2004 ( ) Dr Stephen Swift 1.2 Introduction to Algorithms.
VESL-Career & life planning Career Presentation April 13, 2011 Mt.SAC.
CS 110: Introduction to Computer Science Frequently asked questions about a CS major and CS career.
Computer Science Department Sonoma State University.
 Day 59 Computer Science and Industry Exploring The Intersection Between CS and Other Fields.
Unit 2 (task 28) In this PowerPoint I will tell you about 7 important IT job roles and if a candidate might want one what he would have to do to get one.
How Solvable Is Intelligence? A brief introduction to AI Dr. Richard Fox Department of Computer Science Northern Kentucky University.
Helping Your Child Learn Math Fayetteville Elementary School November 17, 2011.
Women In Computer Science (WICS) Computer and Information Science Dept. University of Oregon.
Unit 8 LANGUAGE FOCUS. Content  Word study  Word used in Computing and Telephoning  Grammar  Pronoun  Indirect speech with conditional sentences.
CSE8A: Introduction to Programming in Java Fall 2012 Prof. Christine Alvarado cse8afall.weebly.com.
CS 127 Introduction to Computer Science. What is a computer?  “A machine that stores and manipulates information under the control of a changeable program”
Name: Ranzl Shinh Pinili Teacher: Mr. Dodds Civic and Career.
The problem that needs to be solved is if a computer career is for me.
Multimedia Artists/Animators PowerPoint Written by Kyle Xayyavong 2 nd period Info Tech.
Numeracy Tutor Times 1)Brain Gym 2)Logic Riddles – choice of 3 arranged in increasing difficulty.
IT Job Roles. ICT Technician An ICT technician is a person who works in an IT based environment and their job is to fix any computer that is not functioning.
Logic Development Problems. Puzzle #1 You have a measurement scale where on both sides you can put some balls for weighing. You have a set of eight balls,
Parklands Junior School Maths Workshop M.Aziz.
STEM DIVERSITY SUMMIT Science, Technology, Engineering and Mathematics “The POWER of STEM” S. Jane Fritz St. Joseph’s College Department of Mathematics/Computer.
CS Educators Summit Jenna Garcia District Manager May 4, 2016.
Session 5: How Search Engines Work. Focusing Questions How do search engines work? Is one search engine better than another?
School of Computer Science Carnegie Mellon University
Artificial Intelligence
Computer Science, Computer Engineering Misconceptions, and career Paths Trey Modi.
Career JEOPARDY! Cluster: Information Technology
— Grade 10 Career Studies Submitted to: Ms. Schuur
Computational Thinking
Computer Science Education Week
COLLEGE OF SCIENCE AND TECHNOLOGY
R for Data Science Data science Data science is a booming field in today’s world. Since Artificial Intelligence is the main focus of today’s technology,
Presentation transcript:

? What is Computer Science and what can you do with it

Problem Solving Learn how to build Algorithms... a sequence of steps/instructions to solve a problem Algorithm type Puzzle 1.: A farmer has to get the goat, the carrot and the wolf over the river to the grassy field. But he can only take one of them with him at a time …

Problem Solving If left alone: the wolf will eat the goat and the goat will eat the carrot

you have a pair of scales you have 12 coins 11 weigh the same the other is heavier How do you find the heavy coin if you are allowed 3 weighings?.. Problem Solving Algorithm type Puzzle 2.

Programming a computer can only do what it is told to do a program is a set of instructions telling a computer what to do. To illustrate this try giving your friend instructions on how to make a peanut butter sandwich. See what happens and how careful you have to be giving each step clearly! There are programs that run the functions in your cell phone, programs that let you view your digital pictures, and many, many more…..

Internet and Instant Messenger Do you use ? Have you ever wondered how your message goes from your computer to your friend’s computer? Do you use IM? Have you ever wondered how it works? The science of computer science is behind it all!

The Brain + Computer Science We can use computers to see what happens in a person’s brain when they think, and to model how the brain solves problems We can use computer science to find patterns in DNA, model biological systems, determine the structure of molecules, and much much more… Biology + Computer Science

Cryptography codes FPVRAPR Key A: N B: O C: P D: Q E: R F: S G: T H: U I: V J: W K: X L: Y M: Z What’s the secret word below?

Creating Websites

Web Site Building

Graphics: Art + Computer Science

Human Computer Interaction Automatic Sign Translation Learning Technologies Human Vehicle Communications

Speech Recognition When's the next plane to Boston? The next train to Austin leaves at 4:45pm. when a system is likely to make errors? How do we keep users happy

Talking heads Developed by OHSU Center for Spoken Language Understanding, CU Center for Spoken Language Research, UoE Centre for Speech Technology Research, and UC Santa Cruz Perceptual Science Laboratory

Talking Heads Developed by OHSU Center for Spoken Language Understanding, CU Center for Spoken Language Research, UoE Centre for Speech Technology Research, and UC Santa Cruz Perceptual Science Laboratory

Artificial Intelligence + Computer Science The Captcha Project was developed by computer scientists from the Aladdin Center at Carnegie Mellon

Cognition Action Perception Camera Sonar Laser range-finders Planning Scheduling Machine Learning Manipulation Locomotion Navigation Robotics

Robotics Cognition Action Perception Camera Sonar Laser range-finders Planning Scheduling Machine Learning Manipulation Locomotion Navigation

RoboCup

RoboCup Robot Soccer at Carnegie Mellon is led by computer scientist Professor Manuela Veloso and her team. To find out more check out:

Useful Skills for CS Computer science Mathematics and logic Join the math club (?) Science Join the robotics club (?) Teamwork skills Communication skills

Classes Computer Science Mathematics Engineering and Science Languages, Literature, Arts ….. Required Minor Free Electives Undergraduate Computer Science Studies include:

 Software Engineer  3D Graphics Programmer  Software Developer  Finance Analyst  Research Assistant  Design Engineer  Web Developer  Game Programmer  Application Developer  Consultant Job list courtesy of Kevin Collins, SCS Career Advisor Jobs: With a Bachelors degree in Computer Science you can be:

 Analyst  Artificial Intelligence Engineer  Automation Engineer  Business Consultant  Business Development Associate  Documentation Tools Specialist  Interface Designer  Issue Associate  IT Development Program Associate  Patent Examiner, Computer Networks Division  Quantum Computing Researcher  Research Associate  Usability Consultant  User Interface Coordinator  Web Experience Developer Job list courtesy of Kevin Collins, SCS Career Advisor

Hardware and Software:  Dell  IBM  Intel  Microsoft  Boeing  Apple Arts and Entertainment:  Dolby  Lucas Arts Film Company  Pixar Animation Studios  Walt Disney Imaging Financial Institutions  Goldman Sachs  Morgan Stanley  Merrill Lynch Consulting:  Accenture  Deloitte&Touche  PriceWaterhouseCoopers Web Browsers:  Google  Amazon  Yahoo  Vivisimo You Could Work For:

Answer puzzle 1. split into 3 lots of 4 take the first 4 coins and weigh against second lot with one weighing you know if the heavy coin is in the 1st or 2nd group because the balance will go down … or if they stay balanced it's in the 3rd group now take your group of 4 coins and split into 2's now you can separate the pair and see which is the heavy coin. To make this a more difficult problem try finding the coin of different weight without knowing if it's heavier or lighter.... think about it...

Puzzle 2. You come to a fork in the road and meet a pair of twins and ask the way to go. One twin always tells the truth One twin always tells lies. How do you decide which way to go?

Puzzle 3. Three children sit one behind the other in a row. The third child can see the first two, the second child can only see the first and the first child can't see either of the other two. A teacher has a box of five hats, two red ones and three black ones. The teacher places a different hat on each of the three children. She instructs each one to call out the color of their hat once they are sure of it. All of the children are perfectly logical. Within a few minutes the first child correctly states the color of her hat. What color is it?

Puzzle 4. There is a certain type of rope that when lit at one end, will take an hour to burn. The burning however is not uniform and so it might, for example, take ten minutes for the first half to burn and fifty minutes for the second half to burn. You have two such ropes, but they are not identical Your number of matches is not a concern. How can you measure exactly 45 minutes?

Answer puzzle 2. You say to the twin "If I asked your twin which road to take what would she say? "....and then you take the other road...

Answer Puzzle 3 Black. If the third child does not reply first then she must be confused by the hats of the other two. If the hats of the first two were red, then the third would know she had a black. The second child, hearing the silence of the third realizes that he and the first child can't both have red hats. If the first child has a red hat then the second child knows, since he cannot also have a red hat, that his hat is black. The first child, noticing the silence of the other two, realizes that she cannot have a red hat. Therefore, her hat must be black.

Answer Puzzle 4. You set the two ends of one rope and one end of the second rope on fire. Once the first rope has burned out a half hour has passed. By lighting the other end of the second rope at that time, it will take fifteen additional minutes for the second rope to completely burn out.