Multiple Sequence Alignment. An alignment of heads.

Slides:

Advertisements

Similar presentations

Multiple Alignment Anders Gorm Pedersen Molecular Evolution Group

Advertisements

Alignment methods Introduction to global and local sequence alignment methods Global : Needleman-Wunch Local : Smith-Waterman Database Search BLAST FASTA.

Multiple Sequence Alignment

Gapped Blast and PSI BLAST Basic Local Alignment Search Tool ~Sean Boyle Basic Local Alignment Search Tool ~Sean Boyle.

 Aim in building a phylogenetic tree is to use a knowledge of the characters of organisms to build a tree that reflects the relationships between them.

1 ALIGNMENT OF NUCLEOTIDE & AMINO-ACID SEQUENCES.

Lecture 1 Sequence Alignment. Sequence alignment: why? Early in the days of protein and gene sequence analysis, it was discovered that the sequences from.

1 “INTRODUCTION TO BIOINFORMATICS” “SPRING 2005” “Dr. N AYDIN” Lecture 4 Multiple Sequence Alignment Doç. Dr. Nizamettin AYDIN

. Class 5: Multiple Sequence Alignment. Multiple sequence alignment VTISCTGSSSNIGAG-NHVKWYQQLPG VTISCTGTSSNIGS--ITVNWYQQLPG LRLSCSSSGFIFSS--YAMYWVRQAPG.

Multiple alignment June 29, 2007 Learning objectives- Review sequence alignment answer and answer questions you may have. Understand how the E value may.

Bioinformatics and Phylogenetic Analysis

What you should know by now Concepts: Pairwise alignment Global, semi-global and local alignment Dynamic programming Sequence similarity (Sum-of-Pairs)

Reminder -Structure of a genome Human 3x10 9 bp Genome: ~30,000 genes ~200,000 exons ~23 Mb coding ~15 Mb noncoding pre-mRNA transcription splicing translation.

Multiple Sequence Alignment. Multiple Alignment- First pair Align the two most closely-related sequences first. This alignment is then ‘fixed’ and will.

Performance Optimization of Clustal W: Parallel Clustal W, HT Clustal and MULTICLUSTAL Arunesh Mishra CMSC 838 Presentation Authors : Dmitri Mikhailov,

Multiple sequence alignments and motif discovery Tutorial 5.

Alignment methods June 26, 2007 Learning objectives- Understand how Global alignment program works. Understand how Local alignment program works.

Multiple sequence alignment

Multiple Sequence Alignment. Alignment can be easy or difficult Easy Difficult due to insertions or deletions (indels)

Multiple Sequence Alignments

Dynamic Programming. Pairwise Alignment Needleman - Wunsch Global Alignment Smith - Waterman Local Alignment.

Project Phase II Report l Due on 10/20, send me through l Write on top of Phase I report. l 5-20 Pages l Free style in writing (use 11pt font or.

CECS Introduction to Bioinformatics University of Louisville Spring 2003 Dr. Eric Rouchka Lecture 3: Multiple Sequence Alignment Eric C. Rouchka,

Multiple Sequence Alignment. Overview of ClustalW Procedure 1 PEEKSAVTALWGKVN--VDEVGG 2 GEEKAAVLALWDKVN--EEEVGG 3 PADKTNVKAAWGKVGAHAGEYGA 4 AADKTNVKAAWSKVGGHAGEYGA.

CISC667, F05, Lec8, Liao CISC 667 Intro to Bioinformatics (Fall 2005) Multiple Sequence Alignment Scoring Dynamic Programming algorithms Heuristic algorithms.

Introduction to Bioinformatics From Pairwise to Multiple Alignment.

Alignment methods II April 24, 2007 Learning objectives- 1) Understand how Global alignment program works using the longest common subsequence method.

CS 177 Sequence Alignment Classification of sequence alignments

Chapter 5 Multiple Sequence Alignment.

Multiple Sequence Alignment CSC391/691 Bioinformatics Spring 2004 Fetrow/Burg/Miller (Slides by J. Burg)

Sequence Alignment and Phylogenetic Prediction using Map Reduce Programming Model in Hadoop DFS Presented by C. Geetha Jini (07MW03) D. Komagal Meenakshi.

Multiple sequence alignment

Multiple Sequence Alignments and Phylogeny.  Within a protein sequence, some regions will be more conserved than others. As more conserved,

Multiple Sequence Alignment May 12, 2009 Announcements Quiz #2 return (average 30) Hand in homework #7 Learning objectives-Understand ClustalW Homework#8-Due.

Some Independent Study on Sequence Alignment — Lan Lin prepared for theory group meeting on July 16, 2003.

1 Generalized Tree Alignment: The Deferred Path Heuristic Stinus Lindgreen

Sequence Analysis CSC 487/687 Introduction to computing for Bioinformatics.

Scoring Matrices April 23, 2009 Learning objectives- 1) Last word on Global Alignment 2) Understand how the Smith-Waterman algorithm can be applied to.

Bioinformatics Multiple Alignment. Overview Introduction Multiple Alignments Global multiple alignment –Introduction –Scoring –Algorithms.

Multiple alignment: Feng- Doolittle algorithm. Why multiple alignments? Alignment of more than two sequences Usually gives better information about conserved.

Sequence Alignment Only things that are homologous should be compared in a phylogenetic analysis Homologous – sharing a common ancestor This is true for.

That have been aligned so that homologous residues are arranged in columns as much as possible. The sequences have different lengths, which means that.

PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1.

Multiple sequence alignment Dr Alexei Drummond Department of Computer Science Semester 2, 2006.

Multiple sequence alignment

Copyright OpenHelix. No use or reproduction without express written consent1.

Multiple Alignment and Phylogenetic Trees Csc 487/687 Computing for Bioinformatics.

COT 6930 HPC and Bioinformatics Multiple Sequence Alignment Xingquan Zhu Dept. of Computer Science and Engineering.

Sequence Alignment.

Burkhard Morgenstern Institut für Mikrobiologie und Genetik Molekulare Evolution und Rekonstruktion von phylogenetischen Bäumen WS 2006/2007.

Sequence Alignment Abhishek Niroula Department of Experimental Medical Science Lund University

1 Multiple Sequence Alignment(MSA). 2 Multiple Alignment Number of sequences >2 Global alignment Seek an alignment that maximizes score.

An Improved Search Algorithm for Optimal Multiple-Sequence Alignment Paper by: Stefan Schroedl Presentation by: Bryan Franklin.

Biology 224 Instructor: Tom Peavy October 18 & 20, Multiple Sequence.

Techniques for Protein Sequence Alignment and Database Searching G P S Raghava Scientist & Head Bioinformatics Centre, Institute of Microbial Technology,

Pairwise Sequence Alignment. Three modifications for local alignment The scoring system uses negative scores for mismatches The minimum score for.

Homologues finding and Multiple Sequence Alignment Maya Schushan November 2010.

Multiple Sequence Alignment Dr. Urmila Kulkarni-Kale Bioinformatics Centre University of Pune

Multiple sequence alignments with Clustal Omega Yu He 04/13/2016 Adapted from Mingchao Xie and Julie Thompson multiple sequence alignment ppt online.

Multiple Sequence Alignment

INTRODUCTION TO BIOINFORMATICS

Multiple sequence alignment (msa)

The ideal approach is simultaneous alignment and tree estimation.

Overview of Multiple Sequence Alignment Algorithms

B3- Olympic High School Bioinformatics

Multiple Sequence Alignment

In Bioinformatics use a computational method - Dynamic Programming.

Protein structure prediction.

MULTIPLE SEQUENCE ALIGNMENT

Presentation transcript:

Multiple Sequence Alignment

An alignment of heads

Sequence Alignment A way of arranging the primary sequences of DNA, RNA and amino acid to identify the regions of similarity that may be a consequence of functional, structural or evolutionary relationship between the sequences.

Goals To establish an hypothesis of positional homology between bases/amino acids. To generate a concise, information-rich summary of sequence data. Sometimes used to illustrate the dissimilarity between a group of sequences. Alignments can be treated as models that can be used to test hypotheses.

Sequence Alignment Aligned sequences of nucleotide or amino acid residues are typically represented as rows within a matrix. Gaps (symbol “-”) are inserted between the residues so that residues with identical or similar characters are aligned. GGGAATCTAGGACTATACCGGATCTA GGGAATCTA--ACTATA--GGATCTA GGG--TCTAGGACTATACCGGAT--A Taxon A Taxon B Taxon C

Alignment can be easy or difficult Easy Difficult due to insertions or deletions (indels)

Protein Alignment may be guided by Tertiary Structure Interactions Homo sapiens DjlA protein Escherichia coli DjlA protein

Multiple Sequence Alignment- Approaches 3 main approaches of alignment: -Manual -Automatic -Combined

Manual Alignment Might be carried out because: -Alignment is easy. -There is some extraneous information (structural). -Automated alignment methods have encountered the local minimum problem. -An automated alignment method can be “improved”.

Automatic Alignment: Progressive Approach Devised by Feng and Doolittle in Essentially a heuristic method and as such is not guaranteed to find the ‘optimal’ alignment. Requires n-1+n-2+n-3...n-n+1 pairwise alignments as a starting point. Most successful implementation is CLUSTAL.

Overview of ClustalW Procedure 1 PEEKSAVTALWGKVN--VDEVGG 2 GEEKAAVLALWDKVN--EEEVGG 3 PADKTNVKAAWGKVGAHAGEYGA 4 AADKTNVKAAWSKVGGHAGEYGA 5 EHEWQLVLHVWAKVEADVAGHGQ Hbb_Human 1 - Hbb_Horse Hba_Human Hba_Horse Myg_Whale Hbb_Human Hbb_Horse Hba_Horse Hba_Human Myg_Whale alpha-helices Quick pairwise alignment: calculate distance matrix Neighbor-joining tree (guide tree) Progressive alignment following guide tree ClustalW