CS273a Lecture 14, Fall 08, Batzoglou CS273a Lecture 14, Fall 2008 Finding Conserved Elements (1) Binomial method  25-bp window in the human genome 

Slides:

Advertisements

Similar presentations

Motivation “Nothing in biology makes sense except in the light of evolution” Christian Theodosius Dobzhansky.

Advertisements

GS 540 week 5. What discussion topics would you like? Past topics: General programming tips C/C++ tips and standard library BLAST Frequentist vs. Bayesian.

Reference mapping and variant detection Peter Tsai Bioinformatics Institute, University of Auckland.

Measuring the degree of similarity: PAM and blosum Matrix

Profile Hidden Markov Models Bioinformatics Fall-2004 Dr Webb Miller and Dr Claude Depamphilis Dhiraj Joshi Department of Computer Science and Engineering.

Genome-wide Regulatory Complexity in Yeast Promoters Zhu YANG 15 th Mar, 2006.

Applications of Hidden Markov Models in the Avian/Mammalian Genome Comparison Christine Bloom Animal Science College of Agriculture University of Delaware.

CS273a Lecture 10, Aut 08, Batzoglou CS273a Lecture 10, Fall 2008 Neutral Substitution Rates.

Evolution at the DNA level …ACGGTGCAGTTACCA… …AC----CAGTCCACCA… Mutation SEQUENCE EDITS REARRANGEMENTS Deletion Inversion Translocation Duplication.

CS273a Lecture 8, Win07, Batzoglou Evolution at the DNA level …ACGGTGCAGTTACCA… …AC----CAGTCCACCA… Mutation SEQUENCE EDITS REARRANGEMENTS Deletion Inversion.

Profile-profile alignment using hidden Markov models Wing Wong.

CS273a Lecture 11, Aut 08, Batzoglou Multiple Sequence Alignment.

[Bejerano Aut08/09] 1 MW 11:00-12:15 in Beckman B302 Profs: Serafim Batzoglou, Gill Bejerano TA: Cory McLean.

Evolution (1 st lecture). Finding Elements in DNA Conserved by Evolution Characterization of Evolutionary Rates and Constraints in Three Mammalian Genomes.

Lecture 9 Hidden Markov Models BioE 480 Sept 21, 2004.

CS273a Lecture 10, Aut 08, Batzoglou Multiple Sequence Alignment.

We have shown that: To see what this means in the long run let α=.001 and graph p:

Identifying functional residues of proteins from sequence info Using MSA (multiple sequence alignment) - search for remote homologs using HMMs or profiles.

CS273a Lecture 10, Aut 08, Batzoglou CS273a Lecture 10, Fall 2008 Local Alignments.

Chapter 4 The Normal Distribution EPS 625 Statistical Methods Applied to Education I.

CS273a Lecture 9/10, Aut 10, Batzoglou Multiple Sequence Alignment.

Molecular Evolution, Part 2 Everything you didn’t want to know… and more! Everything you didn’t want to know… and more!

Computational Genomics Lecture 1, Tuesday April 1, 2003.

Profile Hidden Markov Models PHMM 1 Mark Stamp. Hidden Markov Models  Here, we assume you know about HMMs o If not, see “A revealing introduction to.

Sequence Alignments Revisited

Find the indicated z score: z = Find the indicated z score:.6331 z 0 z = –

Alignment IV BLOSUM Matrices. 2 BLOSUM matrices Blocks Substitution Matrix. Scores for each position are obtained frequencies of substitutions in blocks.

Short Primer on Comparative Genomics Today: Special guest lecture 12pm, Alway M108 Comparative genomics of animals and plants Adam Siepel Assistant Professor.

Journal club 06/27/08. Phylogenetic footprinting A technique used to identify TFBS within a non- coding region of DNA of interest by comparing it to the.

BNFO 602/691 Biological Sequence Analysis Mark Reimers, VIPBG

Sequencing a genome and Basic Sequence Alignment

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

BNFO 602/691 Biological Sequence Analysis Mark Reimers, VIPBG

Introduction to Profile Hidden Markov Models

Chapter 8 Extension Normal Distributions. Objectives Recognize normally distributed data Use the characteristics of the normal distribution to solve problems.

“Hotspot” algorithm chr5:131,975, ,012,092 Idea: gauge enrichment of tags relative to a local background model based on the number of tags in a 50kb.

Eric C. Rouchka, University of Louisville SATCHMO: sequence alignment and tree construction using hidden Markov models Edgar, R.C. and Sjolander, K. Bioinformatics.

Warm Up 1.) What is the simplified form of –x2(2x3 + 5x2 + 6x)?

Sequencing a genome and Basic Sequence Alignment

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

Math 22 Introductory Statistics Chapter 8 - The Binomial Probability Distribution.

Inferring phylogenetic trees: Maximum likelihood methods Prof. William Stafford Noble Department of Genome Sciences Department of Computer Science and.

CS5263 Bioinformatics Lecture 20 Practical issues in motif finding Final project.

Calculating branch lengths from distances. ABC A B C----- a b c.

Lecture 9 CS5661 RNA – The “REAL nucleic acid” Motivation Concepts Structural prediction –Dot-matrix –Dynamic programming Simple cost model Energy cost.

5.3Product of Two Binomials. Remember! Powers/Exponents: Distributing:

The Standard Normal Distribution Section 5.2. The Standard Score The standard score, or z-score, represents the number of standard deviations a random.

Comp. Genomics Recitation 9 11/3/06 Gene finding using HMMs & Conservation.

§ 5.3 Normal Distributions: Finding Values. Probability and Normal Distributions If a random variable, x, is normally distributed, you can find the probability.

Cis-regulatory Modules and Module Discovery

Input: Alignment. Model parameters from neutral sequence Estimation example.

Probabilistic methods for phylogenetic tree reconstruction BMI/CS 576 Colin Dewey Fall 2015.

A knowledge-based approach to integrated genome annotation Michael Brent Washington University.

CHANGING FORMS OF QUADRATICS. Converting from Vertex Form to Standard Form  Multiply out the binomial squared.  Distribute if there is a term out front.

Objective The student will be able to: multiply two polynomials using the distributive property.

Indel rates and probabilistic alignments Gerton Lunter Budapest, June 2008.

CHAPTER 14: Binomial Distributions*

Discrete Probability Distributions

(B.P :51) ( B:P52 ).

Workshop on the analysis of microbial sequence data using ARB

Inferring phylogenetic trees: Distance and maximum likelihood methods

Ашық сабақ 7 сынып Файлдар мен қапшықтар Сабақтың тақырыбы:

Chapter 7: Introduction to Sampling Distributions

Windows басқару элементтері

Alignment IV BLOSUM Matrices

Қош келдіңіздер!.

Discussion Section Week 9

Информатика пән мұғалімі : Аитова Карима.

Volume 7, Issue 2, Pages e11 (August 2018)

Statistics 101 Chapter 8 Section 8.1 c and d.

Presentation transcript:

CS273a Lecture 14, Fall 08, Batzoglou CS273a Lecture 14, Fall 2008 Finding Conserved Elements (1) Binomial method  25-bp window in the human genome  Binomial distribution of k matches in N bases given the neutral probability of substitution

CS273a Lecture 14, Fall 08, Batzoglou CS273a Lecture 14, Fall 2008 Finding Conserved Elements (2) Parsimony Method  Count minimum # of mutations explaining each column  Assign a probability to this parsimony score given neutral model  Multiply probabilities across 25-bp window of human genome A C A A G

CS273a Lecture 14, Fall 08, Batzoglou CS273a Lecture 14, Fall 2008 Finding Conserved Elements

CS273a Lecture 14, Fall 08, Batzoglou CS273a Lecture 14, Fall 2008 Finding Conserved Elements (3) GERP

CS273a Lecture 14, Fall 08, Batzoglou CS273a Lecture 14, Fall 2008 Phylo HMMs HMM Phylogenetic Tree Model Phylo HMM

CS273a Lecture 14, Fall 08, Batzoglou CS273a Lecture 14, Fall 2008 Finding Conserved Elements (3)

CS273a Lecture 14, Fall 08, Batzoglou CS273a Lecture 14, Fall 2008 How do the methods agree/disagree?

CS273a Lecture 14, Fall 08, Batzoglou CS273a Lecture 14, Fall 2008 Statistical Power to Detect Constraint L N C: cutoff # mutations D: neutral mutation rate  : constraint mutation rate relative to neutral

CS273a Lecture 14, Fall 08, Batzoglou CS273a Lecture 14, Fall 2008 Statistical Power to Detect Constraint L N C: cutoff # mutations D: neutral mutation rate  : constraint mutation rate relative to neutral