Experimental data of Shore, D. et. al. PNAS 1981, 78, (8), 4833-4837. a = 0.

Slides:

Advertisements

Similar presentations

APS March MeetingDallas, March 22, 2011 FACETING OF MULTICOMPONENT CHARGED ELASTIC SHELLS Rastko Sknepnek, Cheuk-Yui Leung, Liam C. Palmer Graziano Vernizzi,

Advertisements

Macromolecules Nucleic Acids. Nucleic Acid Nucleic acids include deoxyribonucleic acid and ribonucleic acid Nucleic acids are employed in cells as both.

Single-molecule detection of DNA transcription and replication.

Lecture 3/4 Rob Phillips California Institute of Technology (Block et al.) (Wuite et al.)

Lecture 2 Rob Phillips California Institute of Technology (Block et al.) (Wuite et al.)

A spring with a mass of 6 kg has damping constant 33 and spring constant 234. Find the damping constant that would produce critical damping

Spring Force. Compression and Extension  It takes force to press a spring together.  More compression requires stronger force.  It takes force to extend.

UNR, MATH/STAT 352, Spring Definition: Corollary:

Motion of a mass at the end of a spring Differential equation for simple harmonic oscillation Amplitude, period, frequency and angular frequency Energetics.

Energy stored in a Stretched String When stretching a rubber band or a spring, the more we stretch it the bigger the force we must apply.

Foundations of Physics Assignment #12 Elastic Potential Energy Notes.

Modeling projectile motion subject to drag forces PHYS 361 Spring, 2011.

Mass spring damper system Tutorial Test 1. Derive the differential equation and find the transfer function for the following mass spring damper system.

Spring Force. Compression and Extension  It takes force to press a spring together.  More compression requires stronger force.  It takes force to extend.

Read and say! How many words do you know? Click and wait Click!

IP Hooke’s Law © Oxford University Press 2011 Hooke’s Law.

Marc D. Riedel Associate Professor, ECE University of Minnesota EE 5393: Circuits, Computation and Biology ORAND.

Sequencing DNA 1. Maxam & Gilbert's method (chemical cleavage) 2. Fred Sanger's method (dideoxy method) 3. AUTOMATED sequencing (dideoxy, using fluorescent.

November 14, 2013 Mechanical Engineering Tribology Laboratory (METL) Experimental and Analytical Investigation of Transient Friction Abdullah Alazemi Ph.D.

Demonstration of a Universal Surface DNA Computer August 3, 2004 Summarized by Ji-Yoon Park Xingping Su and Lloyd M. Smith* Nucleic Acids Res. 32,

Primer extension * This labelling technique uses random oligonucleotides (usually hexadeoxyribonucleotide molecules- sequences of six deoxynucleotides)

Limitations of Partial Quenching Stephen Sharpe and Ruth Van de Water, University of Washington, Seattle QCD with 3 flavors (u, d, s) possesses an approximate.

Skin temperature, tactile processing, and vividness of the illusion Moseley G L et al. PNAS 2008;105: ©2008 by National Academy of Sciences.

Elastic P E This is the stored energy of any stretched or compressed object. You can find the EP E of an object by taking the object’s stretch (x) and.

Spring Force and Energy Notes

Assessing the Influence of Decadal Climate Variability and Climate Change on Snowpacks in the Pacific Northwest JISAO/SMA Climate Impacts Group and the.

Special Topics in Genomics Motif Analysis. Sequence motif – a pattern of nucleotide or amino acid sequences GTATGTACTTACTATGGGTGGTCAACAAATCTATGTATGA TAACATGTGACTCCTATAACCTCTTTGGGTGGTACATGAA.

Hooke ’ s Law. Elasticity: The ability of an object to return to its original shape after the deforming force is removed.

Relationship between Genotype and Phenotype

Biomolecular implementation of linear I/O systems Lecture 4/7/2016 Oishi, Kazuaki, and Eric Klavins. "Biomolecular implementation of linear I/O systems."

Work Done by Varying Force Physics 513. You May Not Glide Through This One… An air-track glider of mass kg is attached to a spring with force constant.

Coronal Magnetic Field – Force-Free Field and Topology CSI 769 / ASTR 769 Lect. 04, Feb. 14 Spring 2008 References: Aschwanden: Chap. 5.3 – 5.6 Articles:

Energy Stored in springs E p = 1 / 2 kx 2 Where: E p – potential energy stored in spring (J) k – spring constant (N/m) x – amount of stretch/compression.

The Structure of DNA -Identify the components of DNA and how they pair up. -Discuss the scientists responsible for the identification of DNA’s structure.

Date of download: 11/9/2017 Copyright © ASME. All rights reserved.

Aim: How do we explain the work done by a varying force?

Elastic Forces Hooke’s Law.

Relationship between Genotype and Phenotype

1. Inner hair cell of a bullfrog

Nano- to Microscale Dynamics of P-Selectin Detachment from Leukocyte Interfaces. I. Membrane Separation from the Cytoskeleton Evan Evans, Volkmar Heinrich,

Carbon Nanotube Diode Design

Motor Force Homeostasis in Skeletal Muscle Contraction

F. Benedetti, C. Micheletti, G. Bussi, S.K. Sekatskii, G. Dietler

قوانين برگزاري مناقصات و آيين نامه مالي و معاملاتي دانشگاه علوم پزشكي و خدمات بهداشتي ،درماني تهران

Brownian Dynamics Simulation of DNA Condensation

Mechanically Probing the Folding Pathway of Single RNA Molecules

Work Done by a Varying Force

Chromatin Hydrodynamics

Real-Time Feedback Control System for ADITYA-U Tokamak Plasma Position Stabilisation ROHIT et al. Development of transfer function models for the fast.

Ambarish Kunwar, Michael Vershinin, Jing Xu, Steven P. Gross

Chapter III. Structure and function of Nucleic acid

Thomas L. Daniel, Alan C. Trimble, P. Bryant Chase Biophysical Journal

Force on springs F = kx F = restoring force (in N)

Continuous Allosteric Regulation of a Viral Packaging Motor by a Sensor that Detects the Density and Conformation of Packaged DNA Zachary T. Berndsen,

Figure 1 Dissimilar mutation distributions in 88% identical ATP1A2 and ATP1A3 proteins Dissimilar mutation distributions in 88% identical ATP1A2 and ATP1A3.

Revisiting the Central Dogma One Molecule at a Time

Nearest-neighbor model for Tm

Patterns of amino acid usage and its GC-content of synonymous codons in 65 nuclear genomes in this study. Patterns of amino acid usage and its GC-content.

Amino acid sequence homology between XLMO-2 and the mouse, human and zebrafish homologs. Amino acid sequence homology between XLMO-2 and the mouse, human.

Example 1 When a mass of 24kg is hung from the end of a spring, the length of the spring increased from 35cm to 39cm. What is the load on the spring in.

The Fisher information predicts the experimentally measured sensitivity. The Fisher information predicts the experimentally measured sensitivity. A, Sensitivity.

Hooke’s law Robert Hooke, in 1676, noted that for a spring, the extension was proportional to the load. It is now more generally stated that in certain.

Scheme for recovery of viral nucleic acid from microarray spots.

Schematic representation of 5′→3′ exonuclease cleavage of a 5′-labeled (small black star) probe with a 3′-phosphate (grey circle) extension blocker. Schematic.

Fig. 2 Folding motions of the TCO with strain-softening behavior.

Ashley R. Carter, Yeonee Seol, Thomas T. Perkins Biophysical Journal

Volume 93, Issue 8, Pages (October 2007)

A typical chromatogram of meropenem (retention time 2

Presentation transcript:

Experimental data of Shore, D. et. al. PNAS 1981, 78, (8), a = 0

Gemmen, G. J.et. al. Nucleic Acids Res 2006, 34, (10),

a = 15 nm

Eigenmodes for 100 nm long DNA loop with separation of 6 nm and end-angles held fixed First eigenmodeSecond eigenmode

Simulation techniques

Force ( p N ) Extension [nm] Spring constant (pN/nm) dk/dforce (1/nm) % Linear DNA under force – Spring constant renormalization