To Degrade or Not to Degrade: Substrate Recognition by Lon Protease Amy Dinh Department of Microbiology Mentor: Janine E. Trempy, Ph.D.

Protein Misfolding Diseases normal protein abnormal protein protein aggregate

Treatment Issues Aggregates cause disease or caused by disease Cause of abnormal proteins? Result of malfunction of related protein? ADDL aggregates (yellow) coating a neuron in Alzheimer’s Disease. Scientific American

Studying Human Lon with E. coli lon –ATP dependent protease –highly conserved in evolution –four known substrates in E. coli –NO known substrates in humans

Aims Study how E. coli Lon interacts with its substrates Help identify human Lon substrates Substrates with effects on central nervous system Identify relationship between CNS substrates and abnormal proteins

Research Methods E. coli Lon interactions with two substrates –RcsA –SulA Control physiological effects Clear phenotypes

RcsA –transcriptional activator of capsular polysaccharide genes (mucoidy) lon - lon + RcsA intiates CPS transcription RcsA initiates CPS transcription Lon degrades RcsARcsA not degraded Non-mucoid cellMucoid cell

SulA SulA (SOS gene) –halts cell division –filament formation Cells exposed to MMS/UV SulA causes filament formation SulA degraded (lon + )SulA not degraded ((lon - ) Filaments resolved into new cellsCell death

Prior Research RcsA SulA RcsA Competition Hierarchy Proteolytic Binding Site

Lon Domains Ser ATP Binding Site C-terminus Proteolytic Bindng Site aa residue # Met N-terminus velcro domain RcsA recognition Site SulA recognition Site?

Making Mutants Mutagenesis –K11 and Tll strains –Contain antibiotic resistance gene linked to lon –methylating agent: nitrosoguanidine (NTG) –Generation of random point mutations GCATTGCGGGGCTATCGGTCACACTGCATCGTCATCGAATCGGGCGCGCCCTGATTGA CGTAACGCCCCGATAGCCAGTGTGACGTAGCAGTAGCTTAGCCCGCGCGGGACTAACT

Making Mutants 100/ Tet r / Kan r 11 minutes 10 minutes lon DNA Packaging –P1vir Lysates –P1vir Bacteriophage –~100 kb (20 genes)

Making Mutants Transduction –Infection of healthy E. coli with P1vir InfectionRecombination tet r / kan r mutated lon normal lon E.coli P1 vir tet r / kan r mutated lon normal lon P1 vir E.coli

Making Mutants Requires several phases of screening –1. Selection for mutations on lon Mutant behavior re: RcsA

Screening for Mutants 100/ Tet r / Kan r 11 minutes 10 minutes lon Limited DNA capacity

Screening for Mutants Requires several phases of screening –1. Selection for mutations on lon Mutant behavior re: RcsA –2. Screening using temperature selection

Temperature Selection Hypothesis Low temperatures Protein folding normal Wild type behavior High temperatures Abnormal protein folding Mutant behavior

Screening for Mutants Requires several phases of screening –1. Selection for mutations on lon Mutant behavior re: RcsA –2. Screening using temperature selection –3. Screening using temperature selection and MMS Mutant behavior re: SulA

Mutant Classes I: Lon defective with RcsA Normal cells Mucoid

Mutant Classes II: Lon defective with SulA Normal Cell Filamentation/ Cell Death On MMS at 42º

III: Lon defective with RcsA and SulA Mutant Classes Normal cells Mucoid On MMS at 42º Cell Death

Mutant Classes IV: Lon Gone Wild Normal Cell Cell Death At 42º

Mutants Isolated 8 Class I Mutants –Lon Defective with RcsA 3 Class II Mutants –Lon Defective with SulA –Intermediate MMS sensitivity 2 Class IV Mutants –Lon Gone Wild –Validates Temperature Selection Hypothesis

Next Steps Mutant Verification/Identification –Presence of Lon/RcsA/SulA Western Blot –Amplify lon using PCR –Sequence DNA –Compare Mutant Sequence with E. coli lon sequence

Why Bother? Learn how Lon selects its substrates in E. coli A model for Lon in humans Help identify Lon substrates in humans Understand more about age-related protein misfolding diseases

Acknowledgements Dr. Janine Trempy Howard Hughes Medical Institute HHMI Selection Committee Undergraduate Research, Innovation, Scholarship and Creativity (URISC) Program URISC Selection Committee