Fast and Practical Algorithms for Computing Runs Gang Chen – McMaster, Ontario, CAN Simon J. Puglisi – RMIT, Melbourne, AUS Bill Smyth – McMaster, Ontario,

Slides:



Advertisements
Similar presentations
Michael Alves, Patrick Dugan, Robert Daniels, Carlos Vicuna
Advertisements

1 Suffix Arrays: A new method for on-line string searches Udi Manber Gene Myers May 1989 Presented by: Oren Weimann.
Space-for-Time Tradeoffs
Suffix Trees Come of Age in Bioinformatics Algorithms, Applications and Implementations Dan Gusfield, U.C. Davis.
Suffix Trees Construction and Applications João Carreira 2008.
HABATAKITAI Laboratory Everything is String. Computing palindromic factorization and palindromic covers on-line Tomohiro I, Shiho Sugimoto, Shunsuke Inenaga,
Suffix Trees, Suffix Arrays and Suffix Trays Richard Cole Tsvi Kopelowitz Moshe Lewenstein.
A New Compressed Suffix Tree Supporting Fast Search and its Construction Algorithm Using Optimal Working Space Dong Kyue Kim 1 andHeejin Park 2 1 School.
What about the trees of the Mississippi? Suffix Trees explained in an algorithm for indexing large biological sequences Jacob Kleerekoper & Marjolijn Elsinga.
1 Suffix tree and suffix array techniques for pattern analysis in strings Esko Ukkonen Univ Helsinki Erice School 30 Oct 2005 Modified Alon Itai 2006.
Compressed Compact Suffix Arrays Veli Mäkinen University of Helsinki Gonzalo Navarro University of Chile compact compress.
Suffix Sorting & Related Algoritmics Martin Farach-Colton Rutgers University USA.
15-853Page : Algorithms in the Real World Suffix Trees.
A Categorization Theorem on Suffix Arrays with Applications to Space Efficient Text Indexes Meng He, J. Ian Munro, and S. Srinivasa Rao University of Waterloo.
296.3: Algorithms in the Real World
1 Data structures for Pattern Matching Suffix trees and suffix arrays are a basic data structure in pattern matching Reported by: Olga Sergeeva, Saint.
Next Generation Sequencing, Assembly, and Alignment Methods
Goodrich, Tamassia String Processing1 Pattern Matching.
GTCAGATGAGCAAAGTAGACACTCCAGTAACGCGGTGAGTACATTAA exon intron intergene Find Gene Structures in DNA Intergene State First Exon State Intron State.
Design a Data Structure Suppose you wanted to build a web search engine, a la Alta Vista (so you can search for “banana slugs” or “zyzzyvas”) index say.
Boyer-Moore string search algorithm Book by Dan Gusfield: Algorithms on Strings, Trees and Sequences (1997) Original: Robert S. Boyer, J Strother Moore.
Space Efficient Linear Time Construction of Suffix Arrays
Linear Time Algorithms for Finding and Representing all Tandem Repeats in a String Dan Gusfield and Jens Stoye Journal of Computer and System Science 69.
1 Pattern Matching Using n-grams With Algebraic Signatures Witold Litwin[1], Riad Mokadem1, Philippe Rigaux1 & Thomas Schwarz[2] [1] Université Paris Dauphine.
Data Structures Arrays both single and multiple dimensions Stacks Queues Trees Linked Lists.
Recursion, Complexity, and Searching and Sorting By Andrew Zeng.
An Online Algorithm for Finding the Longest Previous Factors Daisuke Okanohara University of Tokyo Karlsruhe, Sep 15, 2008 Kunihiko.
Chapter 7 Space and Time Tradeoffs James Gain & Sonia Berman
Introduction n – length of text, m – length of search pattern string Generally suffix tree construction takes O(n) time, O(n) space and searching takes.
Merge Sort. What Is Sorting? To arrange a collection of items in some specified order. Numerical order Lexicographical order Input: sequence of numbers.
Optimizing multi-pattern searches for compressed suffix arrays Kalle Karhu Department of Computer Science and Engineering Aalto University, School of Science,
1 Pattern Matching Using n-gram Sampling Of Cumulative Algebraic Signatures : Preliminary Results Witold Litwin[1], Riad Mokadem1, Philippe Rigaux1 & Thomas.
Sorting. Pseudocode of Insertion Sort Insertion Sort To sort array A[0..n-1], sort A[0..n-2] recursively and then insert A[n-1] in its proper place among.
CSC 211 Data Structures Lecture 13
CSC 221: Recursion. Recursion: Definition Function that solves a problem by relying on itself to compute the correct solution for a smaller version of.
Book: Algorithms on strings, trees and sequences by Dan Gusfield Presented by: Amir Anter and Vladimir Zoubritsky.
Space-time Tradeoffs for Longest-Common-Prefix Array Construction Simon J. Puglisi and Andrew Turpin
Szymon Grabowski, Marcin Raniszewski Institute of Applied Computer Science, Lodz University of Technology, Poland The Prague Stringology Conference, 1-3.
Suffix trees. Trie A tree representing a set of strings. a b c e e f d b f e g { aeef ad bbfe bbfg c }
UNIT 5.  The related activities of sorting, searching and merging are central to many computer applications.  Sorting and merging provide us with a.
Keisuke Goto, Hideo Bannai, Shunsuke Inenaga, Masayuki Takeda
Everything is String. Closed Factorization Golnaz Badkobeh 1, Hideo Bannai 2, Keisuke Goto 2, Tomohiro I 2, Costas S. Iliopoulos 3, Shunsuke Inenaga 2,
Joint Advanced Student School Compressed Suffix Arrays Compression of Suffix Arrays to linear size Fabian Pache.
ETRI Linear-Time Search in Suffix Arrays July 14, 2003 Jeong Seop Sim, Dong Kyue Kim Heejin Park, Kunsoo Park.
Dipankar Ranjan Baisya, Mir Md. Faysal & M. Sohel Rahman CSE, BUET Dhaka 1000 Degenerate String Reconstruction from Cover Arrays (Extended Abstract) 1.
Suffix Tree 6 Mar MinKoo Seo. Contents  Basic Text Searching  Introduction to Suffix Tree  Suffix Trees and Exact Matching  Longest Common Substring.
Algorithm Analysis with Big Oh ©Rick Mercer. Two Searching Algorithms  Objectives  Analyze the efficiency of algorithms  Analyze two classic algorithms.
Advanced Data Structures Lecture 8 Mingmin Xie. Agenda Overview Trie Suffix Tree Suffix Array, LCP Construction Applications.
Computing smallest and largest repetition factorization in O(n log n) time Hiroe Inoue, Yoshiaki Matsuoka, Yuto Nakashima, Shunsuke Inenaga, Hideo Bannai,
COMP9319 Web Data Compression and Search
Data Coding Run Length Coding
Tries 07/28/16 11:04 Text Compression
Tries 5/27/2018 3:08 AM Tries Tries.
Andrzej Ehrenfeucht, University of Colorado, Boulder
13 Text Processing Hongfei Yan June 1, 2016.
Strings: Tries, Suffix Trees
Space-for-time tradeoffs
Chapter 7 Space and Time Tradeoffs
Chapter 11 Data Compression
Suffix trees.
Pattern Matching 1/14/2019 8:30 AM Pattern Matching Pattern Matching.
Space-for-time tradeoffs
String Data Structures and Algorithms
Pattern Matching 2/15/2019 6:17 PM Pattern Matching Pattern Matching.
Tries 2/23/2019 8:29 AM Tries 2/23/2019 8:29 AM Tries.
Space-for-time tradeoffs
Suffix Arrays and Suffix Trees
Strings: Tries, Suffix Trees
Space-for-time tradeoffs
Sequences 5/17/ :43 AM Pattern Matching.
Presentation transcript:

Fast and Practical Algorithms for Computing Runs Gang Chen – McMaster, Ontario, CAN Simon J. Puglisi – RMIT, Melbourne, AUS Bill Smyth – McMaster, Ontario, CAN CPM, UWO, July 11, 2007

Overview I won’t talk much about runs! Lempel-Ziv (LZ) Factorization How to compute LZ with SA & LCP – Suffix Array & LCP Array Basics (again!) – Two different methods for LZ factorization – CPS1 and CPS2 – Various space time trade-offs Experimental comparison to other approaches

LZ Factorization (Defn) The LZ-factorization, LZ x of string x[1..n] is a factorization x = w 1 w 2...w k such that each w j, j ε 1..k, is either: 1.a letter that does not occur in w 1 w 2...w j-1 ; or 2.the longest substring that occurs at least twice in w 1 w 2...w j. This is the LZ-77 parsing of the input string Also known as the S-Factorization (Crochemore)

LZ Factorization (Ex) abababa a 678 x = a (1,0) … or (5,2) (2,0) (1,1) (1,3)(2,2) baababa (POS,LEN) wjwj POS = Position of some previous occurrence LEN = Factor length Convention: LEN = 0 if factor is a new letter

Applications of LZ Factorization Computing all runs (Kolpakov & Kucherov) Repeats with fixed gap (Kolpakov & Kucherov… again) Branching repeats (Gusfield & Stoye) Sequence Alignment (Crochemore et al.) Local periods (Duval et al.) Data Compression (Lempel & Ziv, many others) Etcetera… LZ Factorization is the computational bottleneck in numerous string processing algorithms

Computing LZ “Traditional” method is to use a suffix tree –Can be computed as a by-product of Ukkonen’s online suffix tree construction algorithm OR –During a bottom-up traversal of a whole tree SA/LCP interval tree (Abouelhoda et al 2004) –Essentially simulating a bottom-up traversal of the suffix tree on the SA/LCP combination Both these approaches use lots of space.

The ubiquitous Suffix Array Sort the n suffixes of x[1..n] into lexorder Store the offsets in an array 8 a 3 aababa 6 aba 1 abaababa 4 ababa 7 ba 2 baababa 5 baba 1 abaababa 2 baababa 3 aababa 4 ababa 5 baba 6 aba 7 ba 8 a abababa a 678 x = SORT

LCP Array Many SA algorithms rely on an additional table: the LCP (longest common prefix) array Can be computed in O(n) time (Kasai et al. 1999) Several practical improvements: space consumption reduced from 13n to 9n (Manzini 2004) LCP Array stores length of Longest Common Prefix between suffixes SA[i] and SA[i-1] 8 0 a 3 1 aababa 6 1 aba 1 3 abaababa 4 3 ababa 7 0 ba 2 2 baababa 5 2 baba

Computing LZ with the SA First “family” of LZ algorithms we call CPS1 CPS1 algorithms compute arrays POS and LEN These arrays give us the factor information for every position (which is more than we require) Also, LEN is a permutation of LCP abababa a 678 x = POS = LEN = LCP =

CPS1: LZ from SA & LCP POS and LEN are computed in a straight left-to- right traversal of the SA/LCP arrays We “ascend” the LCP array, saving indexes on the stack until LCP values decrease Backtrack using the stack to locate the rightmost i1 < i2 with LCP[i1] < LCP[i2] As we go set the larger position with equal LCP to point leftwards to the smaller one 14 lines of C code! x, SA, LCP, POS, LEN arrays → 17n + stack

Overwrite LCP with POS Once POS[SA[i]] has been assigned –SA[i] and LCP[i] are no longer accessed… Reuse the space –Leave SA[i] as is –Assign LCP[i] = POS[SA[i]] –Store LEN separately as before After the traversal of SA/LCP is complete, permute the SA and “LCP” arrays inplace into string order by following all cycles POS array no longer needed → 13n + stack

Eliminate the LEN Array Given POS[i] = p –LEN[i] = longestmatch(x[POS[i]…n],x[i…n]) Compute only the POS values –Permute them into the POS array (as last slide) Compute LEN values only for factors in the parsing Sum of factors lengths required for the parsing is n, still O(n) time LEN array no longer needed → 9n + stack

CPS2: LZ without LCP LCP computation is slow (though linear) –requires extra space: can we drop it? Use SA to search for the longest previous match at each position in the factorization –Problem is: we don’t want any match - we want a match to the left. –When do we stop the search?

8 a 3 aababa 6 aba 1 abaababa 4 ababa 7 ba 2 baababa 5 baba LZ without LCP (cont…) abababa a 678 x = RangeMin SA (1,5) = 1Length = 1 RangeMin SA (3,5) = 1Length = 2 RangeMin SA (3,5) = 1Length = 3 RangeMin SA (3,5) = 4 RangeMin SA (3,5) = 1Length = 3

LZ without LCP (cont…) Use two binary searches to refine range –Incremental use of Manber and Myers search –Could use other search algs (like FM) Preprocess SA for fast RMQ queries –RMQ SA (i,j) returns minimum value in SA[i..j] –Fast implementation of RMQ requires n bytes O(n log n) time, ~6n bytes space –n single character searches –Each search takes O(log n) time

Experiments Implemented CPS algorithms and raced with: 1.Kolpakov and Kucherov’s implementation Computes factors during online construction of the suffix tree (Ukkonen’s algorithm) Tuned specifically for DNA strings 2.Abouelhoda et al’s approach Uses SA and LCP, computes the POS,LEN

Results - Runtimes

Peak Memory Usage

Conclusions KK remains fastest algorithm on DNA CPS1 (13n) is consistently fastest on larger alphabets (notably faster than AKO) CPS1 (9n) provides a nice space time tradeoff CPS2 most suitable if memory is tight

Future Work Computing the LCP array is a burden –Can we speed it up? –Compute it during SA construction? How easily do these algorithms map to compressed SAs? –Overwriting SA/LCP difficult in that setting Can LZ be computed efficiently without using SA/LCP or STree? Can we compute the rightmost previous POS instead of the leftmost? (Veli Makinen )