Copyright, ©, 2002, John Wiley & Sons, Inc.,Karp/CELL & MOLECULAR BIOLOGY 3E Footprints and Shadows Looking for Functional Pieces Within Genomes.

Slides:



Advertisements
Similar presentations
Fossils provide a record of evolution.
Advertisements

Lecture 8 Transcription Initiation Prokaryotic Eukaryotic Reading: Chapter 4 ( ) Chapter 11 Molecular Biology syllabus web siteweb site.
Applied Calculus, 3/E by Deborah Hughes-Hallet Copyright 2006 by John Wiley & Sons. All rights reserved. Section 7.2 Integration by Substitution.
1 Orthologs: Two genes, each from a different species, that descended from a single common ancestral gene Paralogs: Two or more genes, often thought of.
Finding regulatory modules from local alignment - Department of Computer Science & Helsinki Institute of Information Technology HIIT University of Helsinki.
Summer Bioinformatics Workshop 2008 Comparative Genomics and Phylogenetics Chi-Cheng Lin, Ph.D., Professor Department of Computer Science Winona State.
Comparative genomics Joachim Bargsten February 2012.
Advanced Engineering Mathematics by Erwin Kreyszig Copyright  2007 John Wiley & Sons, Inc. All rights reserved. Page 602.
Copyright, ©, 2002, John Wiley & Sons, Inc.,Karp/CELL & MOLECULAR BIOLOGY 3E The Stability of the Genome Duplication, Deletion, Transposition.
Copyright, ©, 2002, John Wiley & Sons, Inc.,Karp/CELL & MOLECULAR BIOLOGY 3E NHEJ Cleaning up loose ends...
Genetica per Scienze Naturali a.a prof S. Presciuttini Human and chimpanzee genomes The human and chimpanzee genomes—with their 5-million-year history.
Copyright, ©, 2002, John Wiley & Sons, Inc.,Karp/CELL & MOLECULAR BIOLOGY 3E DNA Replication MCM proteins and “random completion”
Copyright, ©, 2002, John Wiley & Sons, Inc.,Karp/CELL & MOLECULAR BIOLOGY 3E DNA Repair Drosophila BLM in Double-Strand Break Repair.
Copyright, ©, 2002, John Wiley & Sons, Inc.,Karp/CELL & MOLECULAR BIOLOGY 3E Gene Expression in Eukaryotes Transcription and RNA Processing.
Finding Genes based on Comparative Genomics Robin Raffard November, 30 th 2004 CS 374.
[Bejerano Fall09/10] 1 Milestones due today. Anything to report?
28-Way vertebrate alignment and conservation track in the UCSC Genome Browser Journal club Dec. 7, 2007.
Phylogenetic Shadowing Daniel L. Ong. March 9, 2005RUGS, UC Berkeley2 Abstract The human genome contains about 3 billion base pairs! Algorithms to analyze.
Sequence Analysis. Today How to retrieve a DNA sequence? How to search for other related DNA sequences? How to search for its protein sequence? How to.
Computational Biology, Part 2 Sequence Comparison with Dot Matrices Robert F. Murphy Copyright  1996, All rights reserved.
Main Menu Salas, Hille, Etgen Calculus: One and Several Variables Copyright 2007 © John Wiley & Sons, Inc. All rights reserved. The Indeterminate Form.
Advanced Engineering Mathematics by Erwin Kreyszig Copyright  2007 John Wiley & Sons, Inc. All rights reserved. Page 334.
BNFO 602/691 Biological Sequence Analysis Mark Reimers, VIPBG
Identifying conserved promoter motifs and transcription factor binding sites in plant promoters Endre Sebestyén, ARI-HAS, Martonvásár, Hungary 26th, November,
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.
Comparative Genomics II: Functional comparisons Caterino and Hayes, 2007.
MCB 317 Genetics and Genomics MCB 317 Topic 10, part 2, A Story of Transcription.
BNFO 602/691 Biological Sequence Analysis Mark Reimers, VIPBG
Computational Biology, Part 3 Sequence Alignment Robert F. Murphy Copyright  1996, All rights reserved.
Copyright, ©, 2002, John Wiley & Sons, Inc.,Karp/CELL & MOLECULAR BIOLOGY 3E Control of Gene Expression Prokaryotes and Operons.
발표자 석사 2 년 김태형 Vol. 11, Issue 3, , March 2001 Comparative DNA Sequence Analysis of Mouse and Human Protocadherin Gene Clusters 인간과 마우스의 PCDH 유전자.
Computational Biology, Part D Phylogenetic Trees Ramamoorthi Ravi/Robert F. Murphy Copyright  2000, All rights reserved.
Lecture 25 - Phylogeny Based on Chapter 23 - Molecular Evolution Copyright © 2010 Pearson Education Inc.
Genome alignment Usman Roshan. Applications Genome sequencing on the rise Whole genome comparison provides a deeper understanding of biology – Evolutionary.
Statistical Bioinformatics Genomics Transcriptomics Proteomics Systems Biology.
COURSE OF BIOINFORMATICS Exam_31/01/2014 A.
Copyright, ©, 2002, John Wiley & Sons, Inc.,Karp/CELL & MOLECULAR BIOLOGY 3E DNA Replication Eukaryotes.
Bioinformatic Tools for Comparative Genomics of Vectors Comparative Genomics.
SHI Meng. Abstract Changes in gene expression are thought to underlie many of the phenotypic differences between species. However, large-scale analyses.
Tools for Comparative Sequence Analysis Ivan Ovcharenko Lawrence Livermore National Laboratory.
COMPUTATIONAL BIOLOGIST DR. MARTIN TOMPA Place of Employment: University of Washington Type of Work: Develops computer programs and algorithms to identify.
Page 46a Continued Advanced Engineering Mathematics by Erwin Kreyszig
SOLUTION TO EXERCISE 5.11 Copyright © 2003 John Wiley & Sons, Inc. Sekaran/RESEARCH 4E.
Chapter 61Introduction to Statistical Quality Control, 5th Edition by Douglas C. Montgomery. Copyright (c) 2005 John Wiley & Sons, Inc.
CHAPTER 10 DATA COLLECTION METHODS. FROM CHAPTER 10 Copyright © 2003 John Wiley & Sons, Inc. Sekaran/RESEARCH 4E.
Variable positions in U1A6 snRNA Qie Kuang Qie Kuang
DNAse Hyper-Sensitivity BNFO 602 Biological Sequence Analysis, Spring 2014 Mark Reimers, Ph.D.
What is genomics? Genes, promoters, regulatory elements, alignments, trees, …
VARIATION IN CONSERVATION AMONG DIFFERENT GENES WITHIN THE HERPES SIMPLEX VIRUS TYPE 1, AND ITS CORRELATION WITH FUNCTION Samantha Nadeau & Kerri Callahan.
Finding Motifs Vasileios Hatzivassiloglou University of Texas at Dallas.
The Central Dogma of Molecular Biology DNA  RNA  Protein  Trait.
24-04 Excerpted from Meggs’ History of Graphic Design, Fourth Edition. Copyright 2005, All rights reserved. Published by John Wiley & Sons, Inc.
Synteny - many distantly related species have co- linear maps for portions of their genomes; co-linearity between maize and sorghum, between maize and.
Multiplication Find the missing value x __ = 32.
Substitution Matrices and Alignment Statistics BMI/CS 776 Mark Craven February 2002.
Date of download: 7/7/2016 Copyright © 2016 McGraw-Hill Education. All rights reserved. Pipeline for culture-independent studies of a microbiota. (A) DNA.
Genetics and Evolutionary Biology
Klein, Organic Chemistry 2e
Genomes and Their Evolution
Molecular evolution of Mycobacterium tuberculosis
Depth of Conservation (May/20/2010)
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Influence of the Duplication of CFTR Exon 9 and Its Flanking Sequences on Diagnosis of Cystic Fibrosis Mutations  Ayman El-Seedy, Tony Dudognon, Frédéric.
Alignment of distal NOS2 promoters from cattle, human, and sheep, and the Bov-A2 element. Alignment of distal NOS2 promoters from cattle, human, and sheep,
Chapter 24 Genomics and DNA Sequencing
Similar Figures.
Klein, Organic Chemistry 2e
Volume 8, Issue 1, Pages 9-17 (January 2005)
Problems from last section
Presentation transcript:

Copyright, ©, 2002, John Wiley & Sons, Inc.,Karp/CELL & MOLECULAR BIOLOGY 3E Footprints and Shadows Looking for Functional Pieces Within Genomes

Copyright, ©, 2002, John Wiley & Sons, Inc.,Karp/CELL & MOLECULAR BIOLOGY 3E

Copyright, ©, 2002, John Wiley & Sons, Inc.,Karp/CELL & MOLECULAR BIOLOGY 3E Footprints vs. Shadows Footprints –sequences conserved in “distant” organisms –works less well than you might think –many alignments not functional (about 40%) –typical comparison: mouse and man limited to mammalian conserved sequence primate conserved sequence would be missed

Copyright, ©, 2002, John Wiley & Sons, Inc.,Karp/CELL & MOLECULAR BIOLOGY 3E Footprints vs. Shadows Shadows –sequences conserved in “similar” organisms –not very effective when comparing two organisms –high fraction of pairwise similarity –multiple simultaneous comparisons better primates MORE evolutionary distance than mouse/man

Copyright, ©, 2002, John Wiley & Sons, Inc.,Karp/CELL & MOLECULAR BIOLOGY 3E

Copyright, ©, 2002, John Wiley & Sons, Inc.,Karp/CELL & MOLECULAR BIOLOGY 3E CETP LXR apoB plas 4 exons and flanking regions

Copyright, ©, 2002, John Wiley & Sons, Inc.,Karp/CELL & MOLECULAR BIOLOGY 3E Apo(a) promoter E = exon C = conserved, N = not 9 = TATA, 10 = HNF-alpha

Copyright, ©, 2002, John Wiley & Sons, Inc.,Karp/CELL & MOLECULAR BIOLOGY 3E Gel retention (shift) assay

Copyright, ©, 2002, John Wiley & Sons, Inc.,Karp/CELL & MOLECULAR BIOLOGY 3E Deletion/Transfection Assay of apo(a)

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2025 SlidePlayer.com. Inc. All rights reserved.