An example story OEB 192 11.08.31 (Nature 394:69-72)

Slides:

Advertisements

Similar presentations

An ACEware Presentation Featuring our Special Guest.. Jason Allen.

Advertisements

Senate Proposed 302(b) Allocations House Proposed 302(b) Allocations  302(b) allocations represent the amount each subcommittee will have to spend on.

English, Language Arts and World Language Collaboration Day Welcome to BCIU.

 Have a seat at any table, but please don’t move the chairs around and take out the following:  Your Measurement W.S.  A red writing utensil (in back.

Swim Lessons Fall 2008 Please call for private lessons or lessons for children with special needs. We will do our best to accommodate your requests and.

OEB 192 – Phenotypic diversity & epigenetics.

An example story OEB (Nature 394:69-72)

More on neutral theory OEB 192 – Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.

Genetic exchange in bacteria/archaea OEB 192 –

BIOS E-127 – Evolution of microbes. An example story BIOS E-127 – (Nature 394:69-72)

“Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Saturday May 02 PST 4 PM. Saturday May 02 PST 10:00 PM.

Genetic exchange in bacteria/archaea OEB 192 – (Worobey et al., 2010, last Friday)

Today we went to Character Education, Einstein Time and Science. We are learning about meal worms and wax worms and the life cycles of bugs! Wow! Kindergarten.

History Warm-Ups Week # 34 Dates : May Monday: (Count down 6 lines and draw a line) _______________________________________________________________________________.

Intimations Sunday 13 th April A warm welcome is extended to any visitors to our Palm Sunday service today. There are welcome cards at the end of the pews.

Laws of Life Essay: FINAL DRAFT INSTRUCTIONS. When preparing your FINAL DRAFT, please do the following: 1.After making all corrections, print one final,

September 20, 2012 Please get the following: a handout from the counter a textbook your vocabulary words so we can review a writing utensil.

LISTSERV LISTSERV is a registered trademark (™) licensed exclusively to L-Soft international, Inc., as the name of its mailing list processor product.

This is the story of Simon Shape Hello!. On Monday Simon Shape woke up feeling very hungry so he ate and ate and ate…

How to Create Science Question Index Cards. When questions are assigned... New questions are assigned each week on Monday (Sometimes I may give them to.

Doc.: 18-13/094r2 Submission August 12, 2013 John Notor, Notor Research Slide 1 Agenda for Teleconference Meeting August 12, 14, 16, 2013 Date:

Practice is Fun Weekly Speech Schedule Daily Practice.

Contacts During sessions: Out of hours : Welcome to our December 2015 Newsletter Newsletter.

Mrs. Bocook’s Contact information: phone: (606)

Mrs. Heiberger’s update! Please READ- important field trip information. September 2015 I am asking you to have your child come to school Friday Aug 25th.

An example story BIOL E-127 – 9/24/07 (Nature 394:69-72)

U.S. History Wednesday, through Friday, Welcome Basic Rules: No Food/Drink (Breakfast 1 st Period; Be on Time; Cell Phones; school rules)

A day in my life By Jack Lupton 7C2. Wake Up I wake up at 7.00 I sometimes have a shower after I get up.

 Have a seat at any table, but please don’t move the chairs around and take out the following:  Your SpongeBob Scientific Method Review W.S.  Today’s.

PeriodTimeMinutes 3 rd Period8:00 – 8: rd Period8:45 – 10:1590 Break10:15 – 10: th Period10:30 – 11: th Period11:10 – 12:4090 PeriodTimeMinutes.

Monday October 5, 2015 WARM-UP: QUESTION #1 WEEK OF OCT 5 QUESTION - DESCRIBE HOW THE RESPIRATORY SYSTEM AND THE CIRCULATORY SYSTEM WORK TOGETHER. Unit.

Sunday Sunday April 14 th April 14 th. Today’s message is available for sale after service. $5 per CD See Audio Department to get your copies.

Employee Campaign Managers - You can download and use these templates for various fundraising events to support your United Way workplace campaign. Just.

Events In Liverpool March St Michael’s and Lark Lane Community Centre, Liverpool Wednesday 20 th March :00am - 12:00pm -Free Taster Session.

Cross Country Upcoming Season. New Coaches Coach Gilmore Coach Fosse.

MARCH NHS MEETING MARCH 15 TH, SERVICE If you sign up for an event via an or a sign-up genius, you must actually volunteer at that event.

By Jayson Park. Goals Navigate to prototype Create a Reservation Navigate to Wednesday 11/9 Make a reservation at 4:00PM to 6:00 PM for room L1108 View.

Where are the jobs in the exercise and sport science industry?

Do you have a history of Gestational Diabetes?

Ms. Lauren & Ms. Erin’s Class

Chapter 2 Kenneth J. McLaughlin, Labor Economics Copyright © 2016 Oxford University Press.

Mrs. Bixler’s Class This week in: We are working on:

2B: Additional Information

Chapter 6 Kenneth J. McLaughlin, Labor Economics Copyright © 2016 Oxford University Press.

Chapter 3 Kenneth J. McLaughlin, Labor Economics Copyright © 2016 Oxford University Press.

Thursday, February 8th :30-11:30 a.m.

Managing Human Resources and Labor Relations.

Interested in joining the EPAWG-L listserv? It's easy! Just send an to

School of Public Health and Community Medicine

Mrs. Walton’s Class This week in: We are learning: Important Reminders

Welcoming Message for the 1st 9 weeks

Please enter text Please enter text DD/MM/YY Please enter text

Learner Profile of the Month: Inquirer

Class News Ms. Mayo A Peek at this Week… School

Please feel free to schedule a conference.

$50 per person and 5th person is FREE!

September 3-7, 2017 Mathematics Language Arts

Ask Listen Do Space for your logo here

Mathematics Language Arts

Class News Ms. Mayo A Peek at this Week… School

Cell Theory & how it came to be.

LT. Cunningham’s Class This week in: We are learning:

Short Constructed Response #2

Chapter 11 Kenneth J. McLaughlin, Labor Economics Copyright © 2016 Oxford University Press.

Chapter 4 Kenneth J. McLaughlin, Labor Economics Copyright © 2016 Oxford University Press.

Class News No Spelling This Week! Ms. Mayo A Peek at this Week…

Chapter 8 Kenneth J. McLaughlin, Labor Economics Copyright © 2016 Oxford University Press.

Chapter 5 Kenneth J. McLaughlin, Labor Economics Copyright © 2016 Oxford University Press.

Presentation transcript:

An example story OEB (Nature 394:69-72)

Experimental design

Diversity observed in still medium in 7 days

Diversity & cell counts over time in each environment StillShaken

Maintenance of high diversity requires continued heterogeneity shaken still shaken still

Fitness of each is ‘frequency-dependent’

For Wednesday (9/7) *No meeting on Labor Day, 9/5…

MSI Chalktalk Breakfast Friday, Sept 2 8:45-9:30 am “Multidrug Resistant Enterococci: What makes a good bug go bad?” Michael Gilmore HMS-Ophthalmology Please join us for coffee/tea/pastries at 8:30 am - Directions to 24 Oxford St: -Join MSI-news listserv: and in the body of your , copy the text: subscribe