Molecular methods in Behavioral Ecology and Forensics Clemens Küpper

Outline Sex typing DNA fingerprinting Short tandem repeats / microsatellites -parentage -forensics -estimating relatedness

Sex typing

in monomorphic species such as birds, reptiles and amphibians with genetic sex determination Birds: ♂ ZZ, ♀ ZW several sex typing markers available CHD1 is found on Z and W, intron copies with different length

Sex ratio and survival of Kentish plovers Survival of sons is greater than daughters Mating opportunities for deserting females are higher than for males Polyandrous mating system Male-biased population sex ratio Székely et al. (2004) Behavioral Ecology Kosztolanyi et al. (2011) J Evol Biol

Pitfalls of sex typing poor sample quality can lead to allelic dropout ZZ’ polymorphism in males in some species: fragment pattern like females Moorhens: ZZ’ male have low survival Lee et al. (2002) Evolution 56:

DNA fingerprinting based on non-coding repetitive DNA (minisatellites) after DNA digestion and gel electrophoresis individual characteristic band pattern is visualized relatives share bands Alex Jeffreys (1984)

DNA fingerprinting: Paternity tests Red winged blackbird Westneat (1991) Behavioral Ecology 4:49-60

DNA fingerprinting: Paternity tests Dunnock Burke et al. (1989) Nature 338:

DNA fingerprinting: problems Classic DNA fingerprinting is now rarely used: laborious large amounts of sample needed band assignment by humans is subjective fingerprints on different gels are hard to compare

Microsatellites (or short tandem repeats) single locus co-dominant markers alleles vary in repeat length high mutation rate ( ) many microsats available genetic profiles can be stored in data bases

2. DNA Polymerase stops during replication. Melting and wrong assembly of strands ACCCCACACACACACACACATGGTACCTG TGGGGTGTGTGT GT ACCCCACACACACACACACATGGTACCTG TGGGGTGTGTGTGTGTGTGTACCATGGAC 1. Microsatellite allele with 8 repeats ACCCCACACACACACACACACATGGTACCTG TGGGGTGTGTGTGTGTGTGTGTACCATGGAC 3. Completion of synthesis and repair of strands results in two microsatellite alleles one with 8 and one with 9 repeats ACCCCACACACACACACACATGGTACCTG TGGGGTGTGTGTGTGTGTGTACCATGGAC Microsatellites: mutation process

Females increase heterozygosity in offspring through extra pair fertilizations Foerster et al. (2003) Nature 425:

Validation of Bateman’s principles in the rough-skinned newt Jones et al. (2002) Proc R Lond B 269: Variance for mating (7x) and repr. success (19x) higher in ♂ ♂ than ♀ ♀

Microsatellites in DNA profiling 13 highly polymorphic microsatellite markers with 5 to 20 alleles Tetra- and pentanucleotide motifs 1 in are expected to share identical genetic profiles only needs one DNA molecule for profiling FBI database (CODIS): 9 Mio entries in 2010, mainly offenders but also missing persons 62k investigations aided in 2007

Problems with DNA profiling and data bases falsified DNA profiles (DNA spray, blood and saliva samples) contamination (by sample takers / lab workers) incomplete profiles e.g. if little sample is available match can be higher (e.g. if you happen to have common alleles) relatives share alleles, monozygotic twins have identical twins security of DNA data bases

Calculating relatedness (r) r describes how much genetic information is shared between individuals important for understanding of social evolution occurrence of inbreeding and inbreeding avoidance best estimate require pedigree but need long term studies and relatedness in first generation is unknown dominant markers band sharing coefficient : 2N ab /(N a +N b ) co-dominant markers: Queller Goodnight’s r

Queller Goodnight’s r R = relatedness between individuals x and y where P x = frequency of allele l at locus k within individual x P y = frequency of same allele in individuals to which x is compared P* = frequency of the allele in population at large (background allele frequency) rare alleles are more informative than common alleles negative values possible : less related than pop average Queller and Goodnight (1989) Evolution 43:

Relatedness in haplodiploid species

Relatedness in hyaena packs Van Horn et al. (2004) Mol Ecol 13:

Problems with molecular r estimates Csilléry et al. (2006) Genetics 173: