1 Reverse Factor Algorithm Advisor: Prof. R. C. T. Lee Speaker: L. C. Chen Speeding up on two string matching algorithms, Algorithmica, Vol.12, 1994, pp.247-267.

Slides:



Advertisements
Similar presentations
1 Very fast and simple approximate string matching Information Processing Letters, 72:65-70, G. Navarro and R. Baeza-Yates Advisor: Prof. R. C. T.
Advertisements

1 Average Case Analysis of an Exact String Matching Algorithm Advisor: Professor R. C. T. Lee Speaker: S. C. Chen.
Speaker: C. C. Lin Adviser: R. C. T. Lee
Parameterized Pattern Matching by Boyer-Moore-type Algorithms
Tuned Boyer Moore Algorithm
Parametrized Matching Amir, Farach, Muthukrishnan Orgad Keller.
Two-dimensional pattern matching M.G.W.H. van de Rijdt 23 August 2005.
Advisor: Prof. R. C. T. Lee Speaker: C. W. Lu
1 The MaxSuffix-Matching Algorithm On maximal suffixes and constant-space versions of KMPalgorithm LATIN 2002: Theoretical Informatics : 5th Latin American.
Factor Oracle, Suffix Oracle 1 Factor Oracle Suffix Oracle.
296.3: Algorithms in the Real World
String Recognition Simple case: recognize 1101 “ ” 0 “1” 0 “11” 0 Reset 1 “110” “1101”
Prefix & Suffix Example W = ab is a prefix of X = abefac where Y = efac. Example W = cdaa is a suffix of X = acbecdaa where Y = acbe A string W is a prefix.
1 A simple fast hybrid pattern- matching algorithm Department of Computer Science and Information Engineering National Cheng Kung University, Taiwan R.O.C.
Recuperació de la informació Modern Information Retrieval (1999) Ricardo-Baeza Yates and Berthier Ribeiro-Neto Flexible Pattern Matching in Strings (2002)
1 Morris-Pratt algorithm Advisor: Prof. R. C. T. Lee Reporter: C. S. Ou A linear pattern-matching algorithm, Technical Report 40, University of California,
Advisor: Prof. R. C. T. Lee Reporter: Z. H. Pan
1 Approximate string matching using factor automata Jan Holub and Borivoj Melichar Theoretical Computer Science vol.249 p Speaker: L. C. Chen Advisor:
UMass Lowell Computer Science Analysis of Algorithms Prof. Karen Daniels Fall, 2006 Wednesday, 12/6/06 String Matching Algorithms Chapter 32.
Advisor: Prof. R. C. T. Lee Speaker: Y. L. Chen
1 The Colussi Algorithm Advisor: Prof. R. C. T. Lee Speaker: Y. L. Chen Correctness and Efficiency of Pattern Matching Algorithms Information and Computation,
1 Advisor: Prof. R. C. T. Lee Speaker: G. W. Cheng Two exact string matching algorithms using suffix to prefix rule.
1 The wide window string matching algorithm Longtao He, Binxing Fang, Jie Sui Theoretical Computer Science Volume: 332, Issue: 1-3, February 28, 2005,
1 Rules in Exact String Matching Algorithms 李家同. 2 The Exact String Matching Problem: We are given a text string and a pattern string and we want to find.
1 CSE 417: Algorithms and Computational Complexity Winter 2001 Lecture 15 Instructor: Paul Beame.
UMass Lowell Computer Science Analysis of Algorithms Prof. Karen Daniels Fall, 2001 Lecture 8 Tuesday, 11/13/01 String Matching Algorithms Chapter.
1 String Matching Algorithms Based upon the Uniqueness Property Advisor : Prof. R. C. T. Lee Speaker : C. W. Lu C. W. Lu and R. C. T. Lee, 2007, String.
Boyer-Moore string search algorithm Book by Dan Gusfield: Algorithms on Strings, Trees and Sequences (1997) Original: Robert S. Boyer, J Strother Moore.
1 Rules in Exact String Matching Algorithms 李家同. 2 The Exact String Matching Problem: We are given a text string and a pattern string and we want to find.
1 Two Way Algorithm Advisor: Prof. R. C. T. Lee Speaker: C. C. Yen Two-way string-matching Journal of the ACM 38(3): , 1991 Crochemore M., Perrin.
1 A Fast Algorithm for Multi-Pattern Searching Sun Wu, Udi Manber Tech. Rep. TR94-17,Department of Computer Science, University of Arizona, May 1994.
1 KMP Skip Search Algorithm Advisor: Prof. R. C. T. Lee Speaker: Z. H. Pan Very Fast String Matching Algorithm for Small Alphabets and Long Patterns, Christian,
Smith Algorithm Experiments with a very fast substring search algorithm, SMITH P.D., Software - Practice & Experience 21(10), 1991, pp Adviser:
1 Morris-Pratt Algorithm Advisor: Prof. R. C. T. Lee Speaker: C. W. Lu A linear pattern-matching algorithm, Technical Report 40, University of California,
1 KMP algorithm Advisor: Prof. R. C. T. Lee Reporter: C. W. Lu KNUTH D.E., MORRIS (Jr) J.H., PRATT V.R.,, Fast pattern matching in strings, SIAM Journal.
Quick Search Algorithm A very fast substring search algorithm, SUNDAY D.M., Communications of the ACM. 33(8),1990, pp Adviser: R. C. T. Lee Speaker:
1 Convolution and Its Applications to Sequence Analysis Student: Bo-Hung Wu Advisor: Professor Herng-Yow Chen & R. C. T. Lee Department of Computer Science.
Recuperació de la informació Modern Information Retrieval (1999) Ricardo-Baeza Yates and Berthier Ribeiro-Neto Flexible Pattern Matching in Strings (2002)
1 The Galil-Giancarlo algorithm Advisor: Prof. R. C. T. Lee Speaker: S. Y. Tang On the exact complexity of string matching: upper bounds, SIAM Journal.
The Zhu-Takaoka Algorithm
Reverse Colussi algorithm
Backward Nondeterministic DAWG Matching Algorithm
1 Boyer and Moore Algorithm Adviser: R. C. T. Lee Speaker: H. M. Chen A fast string searching algorithm. Communications of the ACM. Vol. 20 p.p ,
Raita Algorithm T. RAITA Advisor: Prof. R. C. T. Lee
Indexing and Searching
Aho-Corasick Algorithm Generalizes KMP to handle sets of strings New ideas –keyword trees –failure functions/links –output links.
1 Turbo-BM Algorithm Adviser: R. C. T. Lee Speaker: H. M. Chen Deux méthodes pour accélérer l'algorithme de Boyer-Moore, Théorie des Automates et Applications.,
Linear Time Algorithms for Finding and Representing all Tandem Repeats in a String Dan Gusfield and Jens Stoye Journal of Computer and System Science 69.
The Galil-Giancarlo algorithm
A Fast Algorithm for Multi-Pattern Searching Sun Wu, Udi Manber May 1994.
1 Exact Set Matching Charles Yan Exact Set Matching Goal: To find all occurrences in text T of any pattern in a set of patterns P={p 1,p 2,…,p.
On the Use of Regular Expressions for Searching Text Charles L.A. Clarke and Gordon V. Cormack Fast Text Searching.
Recuperació de la informació Modern Information Retrieval (1999) Ricardo-Baeza Yates and Berthier Ribeiro-Neto Flexible Pattern Matching in Strings (2002)
String Matching Chapter 32 Highlights Charles Tappert Seidenberg School of CSIS, Pace University.
1 Speeding up on two string matching algorithms Advisor: Prof. R. C. T. Lee Speaker: Kuei-hao Chen, CROCHEMORE, M., CZUMAJ, A., GASIENIEC, L., JAROMINEK,
Advisor: Prof. R. C. T. Lee Speaker: T. H. Ku
MCS 101: Algorithms Instructor Neelima Gupta
Exact String Matching Algorithms: A Survey Mehreen Ali, Hina Naz Khan, Shumaila Sayyab, Nadeem Iftikhar Department of Bio-Science Mohammad Ali Jinnah University,
MCS 101: Algorithms Instructor Neelima Gupta
Generalization of a Suffix Tree for RNA Structural Pattern Matching Tetsuo Shibuya Algorithmica (2004), vol. 39, pp Created by: Yung-Hsing Peng Date:
Recuperació de la informació Modern Information Retrieval (1999) Ricardo-Baeza Yates and Berthier Ribeiro-Neto Flexible Pattern Matching in Strings (2002)
Advanced Data Structure: Bioinformatics
Source : Practical fast searching in strings
Boyer and Moore Algorithm
Boyer and Moore Algorithm
Tuesday, 12/3/02 String Matching Algorithms Chapter 32
Adviser: R. C. T. Lee Speaker: C. W. Cheng National Chi Nan University
String Data Structures and Algorithms
String Data Structures and Algorithms
Chap 3 String Matching 3 -.
Presentation transcript:

1 Reverse Factor Algorithm Advisor: Prof. R. C. T. Lee Speaker: L. C. Chen Speeding up on two string matching algorithms, Algorithmica, Vol.12, 1994, pp CROCHEMORE, M., CZUMAJ, A., GASIENIEC, L., JAROMINEK, S., LECROQ, T., PLANDOWSKI, W. and RYTTER, W.

2 Rule 1: The Suffix to Prefix Rule For a window to have any chance to match a pattern, in some way, there must be a suffix of the window which is equal to a prefix of the pattern.

3 Basic Ideas Open a window W with size |P| in the text. T |P||P| W p Find the longest suffix of W is also the prefix of pattern. T |P||P| p W Match! Case 1:

4 T |P||P| W p Case 2: T |P||P| W p T |P||P| W p Case 3: |P||P| If there is no such suffix, we move W with length |P|.

5 Preprocessing phase T=GCATCGGCGAGAGTATACAGTACG P=GCAGAGAG L(S): a set contains all prefixes of the pattern G A G A G GA C C C CA We construct the suffix automaton of P. Suffix Automaton

6 Preprocessing: Construct a Suffix Tree P R : the reversal string of P

7 GCATCGCAGAGAGTATACAGTACG GCAGAGAG When there is a match, how do we move the window? T P

8 GCATCGCAGAGAGTATACAGTACG GCAGAGAG T P

9 GCATCGCAGGCAGTATACAGTACG GCAGAGAG T P Find the longest suffix of W is also the prefix of pattern.

10 GCATCGCAGGCAGTATACAGTACG GCAGAGAG T P

11 A Whole Example T=GCATCGCAGAGA GTATACAGTACG P=GCAGAGAG First attempt : GCATCGCAGAGAGTATACAGTACG GCAGAGAG Shift by: 5 (8 - 3) T P

12 GCATCGCAGAGAGTATACAGTACG GCAGAGAG Second attempt : Shift by: 7 (8 - 1) T P

13 Third attempt: GCATCGCAGAGAGTATACAGTACG GCAGAGAG Shift by: 7 (8 - 1) T P

14 Third attempt: GCATCGCAGAGAGTATACAGTACG GCAGAGAG T P

15 Conclusion Preprocessing phase is O (m). Searching phase is O (mn).

16 Reference [A90]Algorithms for finding patterns in strings, A. V. Aho, Handbook of Theoretical Computer Science, Vol. A, Elsevier, Amsterdam, 1990, pp [A85]The myriad virtues of suffix trees, Apostolico, A., Combinatorial Algorithms on words, NATO Advanced Science Institutes, Series F, Vol. 12, 1985, pp [AG86]The Boyer-Moore-Galil string searching strategies revisited, Apostolico, A. and Giancarlo, R., SIAM, Comput. 15, 1986, pp [BR92]Average running time of the Boyer-Moore-Horspool algorithm, Baeza-Yates, R. A. and Regnier, M. Theoret. Comput. Sci., 1992, pp [BKR91]Analysis of algorithms and Data Structures, Banachowski, L., Kreczmar, A. and Rytter, W., Addison- Wesley. Reading, MA,1991.