Signal Processing Problems in Genomics Mohammad Al Bataineh Illinois Institute of Technology Chicago, IL.

Slides:



Advertisements
Similar presentations
Nucleic Acids The amino acid sequence of a polypeptide is programmed by genes. Genes consist of DNA, which is a polymer belonging to the class of compounds.
Advertisements

Nucleic Acids Nucleic Acid Basics Contain instructions to build proteins 2 types: – DNA – RNA Composed of smaller units called nucleotides – Monomer:
Nucleic Acids.
BIOLOGICALLY IMPORTANT MACROMOLECULES NUCLEIC ACIDS.
Biochemistry Part IV Nucleic Acids. Largest organic molecule made by organisms Largest organic molecule made by organisms Include 2 main types: Include.
Molecular Biology Background. Schematic view of DNA organization in a cell.
Nucleic Acids DNA vs. RNA
Nucleic Acids Nucleic Acid Basics Contain instructions to build proteins 2 types: – DNA – RNA Composed of smaller units called nucleotides – Monomer:
DNA and now RNA DNA is deoxyriboneucleic acid. RNA is ribonucleic acid.
Chapter 6 Genes and Gene Technology
DNA. Nucleic Acids Informational polymers Made of C,H,O,N and P No general formula Examples: DNA and RNA.
Date DNA. ✤ DNA stands for deoxyribonucleic acid ✤ DNA carries all the genetic information of living organisms.
DNA Bases. Adenine: Adenine: (A) pairs with Thymine (T) only.
D. NUCLEIC ACIDS 1.ARE MADE OF THE ELEMENTS C,H,O,N,P.
DNA holds the instructions When proteins are produced in the body, the instructions for how to make it comes from the DNA (deoxyribonucleic acid) BUT,
DNA Deoxyribose Nucleic Acid. DNA (deoxyribonucleic acid) Genetic Information in the form of DNA is passed from parent to offspring. Genes are the code.
Protein Synthesis Worksheet Packet
DNA structure.
Nucleic Acids.
Regents Biology Nucleic Acids Information storage.
DNA. Nucleic Acids What are the types of Nucleic Acids?
How Genes Function Quiz 6D. Four main points of how genes function Nucleotides (symbols in the language) are arranged into codons (letters) Codons (letters.
Nucleic Acid Nucleic Acids Examples: – RNA (ribonucleic acid) single helix – DNA (deoxyribonucleic acid) double helix Structure: – monomers = nucleotides.
NUCLEIC ACIDS. The four major classes of macromolecules are: Carbohydrates Proteins Lipids Nucleic acids.
Nucleic Acids Organic Molecules: Carbohydrates Proteins Lipids Nucleic Acids.
DNA AND RNA STUDY GUIDE FOR THE TEST. Name the three molecules DNA is made up of.
Nucleotide Nucleic Acid DNA
Nucleic Acids Nucleic acids provide the directions for building proteins. Two main types…  DNA – deoxyribonucleic acid  Genetic material (genes) that.
RNA  Structure Differences:  1. Instead of being double stranded, RNA is a single stranded molecule. (ss)  2. The sugar in RNA is ribose. It has one.
AS Biology. Gnetic control of protein structure and function.
What do you know about DNA? T. Trimpe 2008
2015/04/10 Jun Min Jung MOLECULAR BIOLOGY & BIOCHEMISTRY.
DNA and RNA Structure and Function Chapter 12 DNA DEOXYRIBONUCLEIC ACID Section 12-1.
The Structure of DNA. DNA is a nucleic acid. There are two types of nucleic acids: __________ or deoxyribonucleic acid __________ or ribonucleic acid.
RNA Ribonucleic Acid Single-stranded
(3) Gene Expression Gene Expression (A) What is Gene Expression?
H.B.2A.1 Construct explanations of how the structures of carbohydrates, lipids, proteins, and nucleic acids (including DNA and RNA) are related.
Mrs. Wharton’s Science Class
Overview of Genetics Genes make us who we are!.
Nucleic Acids.
The DNA Connection.
Nucleic Acids Section 3.5.
Objective: Journal: Describe the process of protein synthesis
Nucleic Acids.
How Genes Function C5L3.
Nucleic Acids 1 1.
Nucleic Acids 2 Types What do they do? DNA- deoxyribonucleic acid
Nucleic Acids.
The Structure & Function of DNA, RNA, and protein.
Nucleic Acids.
DNA and RNA Structure and Function
GENETICS (Geneology) the study of “genes” Inheritable traits that
DNA Notes.
Protein Synthesis.
DNA Notes.
I. DNA.
January 11, 2018 Objective: Journal:
Nucleic Acids.
DNA Vocabulary.
REVIEW DNA DNA Replication Transcription Translation.
RNA.
Making Proteins Transcription Translation.
Title: Nucleic Acids
Friday March 27, 2015 Day 1 1. Please have these Items on your desk.
Lesson 8 Nucleic Acids.
Nucleic Acids.
Nucleic Acids GT Biology .
Essential Question: How cells make proteins
TRANSCRIPTION DNA mRNA.
DNA and RNA.
Presentation transcript:

Signal Processing Problems in Genomics Mohammad Al Bataineh Illinois Institute of Technology Chicago, IL

Why is genomics interesting for the signal processing person? Because there are sequences there! OK, what sort of sequences? 1. Sequences from an alphabet of size four: … ATTCGAAGATTTCAACGGGAAAA … DNA 2. Sequences from an alphabet of size twenty: AACWYDEFGHIKLMNPQRSTVAPPQR Protein

Size-4 alphabet: A, C, T, G: bases (also called or nucleotides) DNA sequences (genomes) are made of these. Genes are parts of DNA, and are 4-letter sequences. Adenine Thymine Cytosine Guanine or Uracil (in RNA) DNA: deoxyribonucleic acid RNA:ribonucleic acid

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2025 SlidePlayer.com. Inc. All rights reserved.