GENETIC MARKERS IN PLANT BREEDING
P = E+G MARKERS IN BIOLOGY 1. Phenotypic markers = Naked eye markers Flower colors, shape of pods, etc.. P = E+G
Karl Von Linne (1707-1778)
2. Genotypic (molecular) markers Readily detectable sequence of protein or DNA whose inheritance can be monitored and associated with the trait inheritance independently from the environment: a) protein polymorphisms b) DNA polymorphisms
Molecular markers Sequencing (SNPs) Microsatellites (SSRs) Multi-locus fingerprints AFLP (Amplified Fragment Length Polymorphism) Resolution power RAPD (random amplified polymorphic DNA) chloroplastDNA PCR-RFLP allozymes (protein-electrophoresis)
Proteins Polymorphisms Seed storage proteins Isozymes
Isozyme
Isozyme Starch gel of the isozyme malate dehydrogenase (MDH). The numbers indicate first the MDH locus, and next the allele present (ie. 3-18 is locus 3 allele 18). Some bands are heterodimers (intralocus or interlocus).
Molecular Marker DNA M1 M2 Gene A Gene B MFG MFG 1 ccacgcgtcc gtgaggactt gcaagcgccg cggatggtgg gctctgtggc tgggaacatg 61 ctgctgcgag ccgcttggag gcgggcgtcg ttggcggcta cctccttggc cctgggaagg 121 tcctcggtgc ccacccgggg actgcgcctg cgcgtgtaga tcatggcccc cattcgcctg 181 ttcactcaga ggcagaggca gtgctgcgac ctctctacat ggacgtacag gccaccactc 241 ctctggatcc cagagtgctt gatgccatgc tcccatacct tgtcaactac tatgggaacc 301 ctcattctcg gactcatgca tatggctggg agagcgaggc agccatggaa cgtgctcgcc 361 agcaagtagc atctctgatt ggagctgatc ctcgggagat cattttcact agtggagcta 421 ctgagtccaa caacatagca attaaggtag gaggagggat ggggatgttg tgtggccgac 481 agttgtgagg ggttgtggga agatggaagc cagaagcaaa aaagagggaa cctgacacta 541 tttctggctt cttgggttta gcgattagtg cccctctctc atttgaactc aactacccat 601 gtctccctag ttctttctct gcctttaaaa aaaaatgtgt ggaggacagc tttgtggag MFG M1 M2 DNA Gene A Gene B AACCTGAAAAGTTACCCTTTAAAGGCTTAAGGAA AAAGGGTTTAACCAAGGAATTCCATCGGGAATTCCG MFG readily detectable sequence of DNA whose inheritance can be monitored and associated with the trait inheritance
Image from UV light table Image from computer screen Image from UV light table
Hybridization based markers Molecular Marker Hybridization molecular based markers PCR molecular based markers Hybridization based markers Examine differences in size of specific DNA restriction fragments Require pure, high molecular weight DNA Usually performed on total cellular genome
DNA/DNA Hybridization Denaturation Elevated temperature Known DNA sequence Restriction Fragment Length Polymorphism
Endonucleases and restriction sequences AAATCGGGACCTAATGGGCC ATTTAGGGCAATTCCAAGGA YFG Ind 1 Ind 2
RFLP techniques
RFLP Polymorphisms interpretation 1 MFG 1 2 3 4 5 6 2 3 4 5 6
Advantages and disadvantages of RFLP Reproducible Co-dominant Simple Disadvantages Time consuming Expensive Use of radioactive probes
Polymerase Chain Reaction Powerful technique for amplifying DNA Amplified DNA are then separated by gel electrophoresis
PCR based methods 1. Reactions conditions *Target DNA ( or template) *Four nucleotides (dATP, dCTP, dGTP, dTTP) PCR based methods 1. Reactions conditions *Target DNA ( or template) *Reaction buffer containing the co-factor MgCl2 *One or more primers *Thermostable DNA polymerase
= an enzyme that can synthesize DNA at elevated temperature 2. Use of DNA polymerase = an enzyme that can synthesize DNA at elevated temperature Example: Taq = enzyme purified from hot spring bacterium ( Thermus aquaticus) 3. Thermal cycle *Denaturing step - one to several min at 94-96 º C *Annealing step - one to several min at 50-65 º C *Elongation step - one to several min at 72 º C 4. Repetition typically 20 to 50 times average 35 times
PCR Based markers Sequencing (SNPs) Microsatellites (SSR) AFLP (Amplified Fragment Length Polymorphism) RAPD (random amplified polymorphic DNA)
RAPD Markers Molecular markers which developed by amplifying random sequence of specific markers through the used of random primers There are other problems with RAPD markers associated with reliability Because small changes in any variable can change the result, they are unstable as markers RAPD markers need to be converted to stable PCR markers The polymorphic RAPD marker band is isolated from the gel It is used a template and re-PCRed The new PCR product is cloned and sequenced Once the sequence is determined, new longer and specific primers can be designed .
RAPD Amplifies anonymous stretches of DNA using arbitrary primers Fast and easy method for detecting polymorphisms Disadvantages: Domimant markers Reproducibility problems
RAPD Polymorphisms among landraces of sorghum Sequences of 10-mer RAPD primers Name Sequence OP A08 5’ –GTGACGTAGG- 3’ OP A15 5’ –TTCCGAACCC- 3’ OP A 17 5’ –GACCGCTTGT- 3’ OP A19 5’ –CAAACGTCGG- 3’ OP D02 5’ –GGACCCAACC- 3’ M RAPD gel configuration
AFLP Markers Most complex of marker technologies Involves cleavage of DNA with two different enzymes Involves ligation of specific linker pairs to the digested DNA Subsets of the DNA are then amplified by PCR The PCR products are then separated on acrylamide gel 128 linker combinations are readily available Therefore 128 subsets can be amplified Patented technology
Technically demanding AFLP Markers Technically demanding Reliable and stable Moderate cost Need to use different kits adapted to the size of the genome being analyzed. Like RAPD markers need to be converted to quick and easy PCR based marker
SSR repeats and primers Molecular markers which developed by amplifying microsatellite in the genome Repeat GGT(5) Sequence GCGCCGAGTTCTAGGGTTTCGGAATTTGAACCGTC ATTGGGCGTCGGTGAAGAAGTCGCTTCCGTCGTTTGATTCCGGTCGTCAGAATCAGAATCAGAATCGATATGGTGGCAGTGGTGGTGGTGGTGGTGGTTTTGGTGGTGGTGAATCTAAGGCGGATGGAGTGGATAATTGGGCGGTTGGTAAGAAACCTCTTCCTGTTAG ATTCTGGAATGGAACCAGATCGCTGGTCTAGAGGTTCTGCTGTGGAACCA….. GAGGGCTGATGAGGTGGATA ATCTTATGGCGGTTCTCGTG
SSR polymorphisms AATCCGGACTAGCTTCTTCTTCTTCTTCTTTAGCGAATTAGG P1 AAGGTTATTTCTTCTTCTTCTTCTTCTTCTTCTTAGGCTAGGCG P2 P1 P2 Gel configuration
SSR scoring for F 5:6 pop from the cross Anand x N97-3708-13 N97 Anand M
(Single Nucleotide Polymorphisms) SNPs (Single Nucleotide Polymorphisms) Molecular markers which their polymorphism can be determined by single nucleotide difference SNPs on a DNA strand Hybridization using fluorescent dyes Any two unrelated individuals differ by one base pair every 1,000 or so, referred to as SNPs. Many SNPs have no effect on cell function and therefore can be used as molecular markers.
DNA sequencing Sequencing gel Sequencer Sequencing graph
Dominant versus Co-dominant No distinction between homo- and heterozygotes possible No allele frequencies available AFLP, RAPD Co-dominant homozygotes can be distinguished from heterozygotes allele frequencies can be calculated microsatellites, SNP, RFLPs
Co-dominant marker Dominant marker Polymorphism -Parent 1 : one band -Parent 2 : a smaller band -Offspring 1 : heterozygote = both bands -Offspring 2 : homozygote parent 1 P 2 P 1 O 2 O 1 Gel configuration Dominant marker Polymorphism Parent 1 : one band -Parent 2 : no band -Offspring 1 : homozygote parent 1 -Offspring 2 : ???? P 2 Gel configuration P 1 O 1 O 2
Desirable properties for a good molecular marker * Polymorphic * Co-dominant inheritance * Occurs throughout the genome * Reproducible * Easy, fast and cheap to detect * Selectivity neutral * High resolution with large number of samples
Use of Molecular Markers Clonal identity Parental analysis Family structure SCALE Population structure Gene flow Phylogeography Hybridisation Phylogeny
USES OF MOLECULAR MARKER Measure genetic diversity Mapping Tagging
Genetic Diversity Define appropriate geographical scales for monitoring and management (epidemology) Establish gene flow mechanism identify the origin of individual (mutation detection) Monitor the effect of management practices manage small number of individual in ex situ collection Establish of identity in cultivar and clones (fingerprint) paternity analysis and forensic
Genetic Diversity
Gotcha! early selection of the good allele fingerprints seeds, plantlets
A linear order of genes or DNA fragments Mapping The determination of the position and relative distances of gene on chromosome by means of their linkage Genetic map A linear arrangement of genes or genetic markers obtained based on recombination Physical map A linear order of genes or DNA fragments
It contains ordered overlapping cloned DNA fragment Physical Mapping It contains ordered overlapping cloned DNA fragment The cloned DNA fragments are usually obtained using restriction enzyme digestion
Chromosomes with morphological Chromosomes with molecular Molecular Maps Molecular markers (especially RFLPs and SSRs) can be used to produce genetic maps because they represent an almost unlimited number of alleles that can be followed in progeny of crosses. R r T t or Chromosomes with morphological marker alleles RFLP1a RFLP2a RFLP4a RFLP3a SSR1a SSR2a RFLP1b RFLP2b RFLP4b RFLP3b SSR1b SSR2b Chromosomes with molecular marker alleles
QTL Mapping A set of procedures for detecting genes controlling quantitative traits (QTL) and estimating their genetics effects and location To assist selection
Multigenic trait; ex: plant growth =Quantitative Trait Loci Types of traits Single gene trait: seed shape Multigenic trait; ex: plant growth =Quantitative Trait Loci MFG MFG
Making A Linkage Map Genotype No. of R642 G320 RG2 C189 Individuals A A A 47 A A B 8 A B A 5 A B B 15 B A A 19 B B A 24 B A B 3 B B B 42 . Total 163 G1465 RG2 G44 G320 RZ141 R642 C189 Rice chromosome 11 Recombinants between G320 and RG2 = 5 + 15 + 19 + 3 = 42 = 26% Recombinants between RG2 and C189 = 8 + 5 + 24 + 3 = 40 = 25% Recombinants between G320 and C189 = 8 + 15 + 19 + 24 = 66 = 40%
Making a Linkage Map 47 8 5 15 19 24 3 42 A A A B B A G320 RG2 C189 B B A 47 8 5 15 19 24 3 42 Frequency of Genotype
Making a Lingkage Map Trait 2.5 8.4 7.1 4.5 2.3 M. 1 1 3 2 M. 2 1 3 M. 3 1 3 2 P.1 P.2 I.1 I.2 I.3 I.4 Statistical programs used in molecular marker studies * SAS * ANOVA * Mapmaker * Cartographer Types of population used for molecular markers studies: F2, RILs, Backcrosses (MILs), DH.
QTL Mapping
Linkage groups
Marker Assisted Selection Breeding for specific traits in plants and animals is expensive and time consuming The progeny often need to reach maturity before a determination of the success of the cross can be made The greater the complexity of the trait, the more time and effort needed to achieve a desirable result The goal to MAS is to reduce the time needed to determine if the progeny have trait The second goal is to reduce costs associated with screening for traits If you can detect the distinguishing trait at the DNA level you can identify positive selection very early.
Marker Assisted Selection Useful when the gene(s) of interest is difficult to select 1. Recessive Genes 2. Multiple Genes for Disease Resistance 3. Quantitative traits 4. Large genotype x environment interaction
Marker Assisted Selection MAS allows for gene pyramiding - incorporation of multiple genes for a trait Prevents development of biological resistance to a gene Reduces space requirements - dispose of unwanted plants and animal early
Developing a Marker Best marker is DNA sequence responsible for phenotype i.e. gene If you know the gene responsible and has been isolated, compare sequence of wild-type and mutant DNA Develop specific primers to gene that will distinguish the two forms
Developing a Marker If gene is unknown, screen contrasting populations Use populations rather than individuals Need to “blend” genetic differences between individual other than trait of interest
Developing Markers Cross individual differing in trait you wish to develop a marker Collect progeny and self or polycross the progeny Collect and select the F2 generation for the trait you are interested in Select 5 - 10 individuals in the F2 showing each trait
Developing Markers Extract DNA from selected F2s Pool equal amounts of DNA from each individual into two samples - one for each trait Screen pooled or “bulked” DNA with what method of marker method you wish to use Method is called “Bulked Segregant Analysis”
Marker Development Other methods to develop population for markers exist but are more expensive and slower to develop Near Isogenic Lines, Recombinant Inbreeds, Single Seed Decent What is the advantage to markers in breeding?