OEB 192 – 11.11.09 Phenotypic diversity & epigenetics.

Slides:

Advertisements

Similar presentations

SCHOOL OF BIOLOGICAL SCIENCES Royal Holloway University of London SCHOOL SEMINARS

Advertisements

Thursday, January 22, 2015MAT 146. Thursday, January 22, 2015MAT Calculate the area between the graphs of y = 2x 3 – 1 and y = x – 1 for 1 ≤ x.

Lecture 10: Diffusive Dynamics Rob Phillips California Institute of Technology Verkman et al.

OEB 192 – Tradeoffs, specialization & pleiotropy.

BIOS E-127– Evolution of pathogens (Grenfell et al., 2004)

BIOS E-127 – Evolution of digital organisms.

OEB 192 – Tradeoffs, specialization & pleiotropy.

OEB 192 – Evolution of pathogens (Grenfell et al., 2004)

An example story OEB (Nature 394:69-72)

OEB 192 – Evolution of cooperation. Important reducer of greenhouse gas emissions (90% of marine methane from marine sediments oxidized by.

OEB 192 – Evolution of pathogens (Grenfell et al., Science)

OEB 192 – Phenotypic diversity & epigenetics.

How follow diversification? MLST for Streptococcus pneumoniae (Fraser et al., 2007) (Feil, 2003) OEB 192 –

OEB 192 – Phenotypic diversity & epigenetics.

An example story OEB (Nature 394:69-72)

OEB 192 – How follow diversification? MLST for Streptococcus pneumoniae (Fraser et al., 2007) (Feil, 2003)

More on neutral theory OEB 192 – Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.

OEB 192 – Optimality & evolution of networks.

Detecting HGT: discordant phylogenies OEB 192 –

OEB 192 – Phenotypic diversity & epigenetics.

OEB 192 – Mutation rate & population size I.

Evolution before Darwin Lamarck: Philosophie Zoologique (1809) OEB 192 – Prior theme music:

Genetic exchange in bacteria/archaea OEB 192 –

BIOS E-127 – Evolution of digital organisms.

BIOS E-127 – Evolution of microbes. An example story BIOS E-127 – (Nature 394:69-72)

Kane 130 Last name A-L Kane 120 Last name M-Z turn off your cell phones & put all your “stuff” away put you name, ID# and version letter on your scantron.

Reminders and Announcements Projects due Thursday, May 5, 2:00 PM by Keep consulting Maja and me for advice if you run into roadblocks or want to.

OEB 192 – Epistasis. (Segrè et al., Nat. Genet.)

Genetic exchange in bacteria/archaea OEB 192 – (Worobey et al., 2010, last Friday)

BIOS E-127 – Diversification & co-evolution.

Species “Species are groups of actually or potentially interbreeding populations, which are reproductively isolated from other such groups” (Mayr, 1942)

Lecture 19 – Epigenomics – Plants

Species “Species are groups of actually or potentially interbreeding populations, which are reproductively isolated from other such groups” (Mayr, 1942)

HC70A Winter 2006 Genetic Engineering in Medicine, Agriculture, and Law Professor Bob Goldberg Class Announcements 2/2/06.

HIV-1 evolution in response to immune selection pressures

Chemistry and Materials for Energy Dallas, Texas March 16-20, 2014 Michelle V. Buchanan Nitash P. Balsara.

Is a community program to provide school supplies and backpacks for children in Wichita Falls.

CLASS 9PM ET ED 572 ACTION RESEARCH 7/18/11 Let me know if you can not hear the music!

Intelligent systems in bioinformatics Introduction to the course.

GTL User Facilities Facility IV: Analysis and Modeling of Cellular Systems Jim K. Fredrickson.

Merging: When To Yield And When To Speed Up Presented by Keystone Computer Concepts.

Single Cell Variability The contribution of noise to biological systems.

1 Illinois Wireless Summer School August 3-7, 2009 University of Illinois at Urbana-Champaign.

College of Social and Behavioral Sciences Poster Symposium Fall 2014.

GPiBS (Graduate Program in Biomedical Sciences) is offered through the Graduate College at the University of Oklahoma Health Sciences Center. GPiBS (Graduate.

OEB 192 – Dynamics of adaptation.

An example story BIOL E-127 – 9/24/07 (Nature 394:69-72)

BIO/BCH/MI/PLS/PPA 601 Special Topics in Molecular and Cellular Genetics Brian Rymond, Biology, 335 T.H. Morgan (THM) Biology Bldg.,

Science and Engineering Library Your Research Center.

Molecular Biology of the Cell

Figure Molecular Biology of the Cell (© Garland Science 2008)

Figure 14-1 Molecular Biology of the Cell (© Garland Science 2008)

‘Now You Can Choose! The Politics and Ethics of Sex Selection’ Barbara Katz Rothman, Professor of Sociology, City University of New York Thursday 1 st.

The Department of Biochemistry & Molecular Biology

Join us for a special Ladies Night of Wine & Roses!

The Biological and Biomedical Joint Seminar Series

Getting Ready for Learning

Comparison of HTGs involved in nutrition synthesis, CIP, bacterial cell wall synthesis, population regulation, and plant or fungal cell wall degradation.

“Stem Cells and Cancer”

© University of Cambridge

Genome Science Theme Seminar

UCSF School of Medicine

INSTITUTE FOR RECRUITMENT OF TEACHERS

Professor Thierry Boon

Genome Science Theme Seminar

Genome Science Theme Seminar

“Signaling Mechanisms Regulating CNS Myelination”

The Biological and Biomedical Joint Seminar Series

Harvard Origins of Life Initiative Third Annual Prize Lecture

CLIMATE CENTER LECTURER Gerard van der Schrier Royal Netherlands Meteorological Institute (KNMI) 27 November to 1 December 2006 Lectures at Lamont-Doherty.

Presentation transcript:

OEB 192 – Phenotypic diversity & epigenetics

(Verstrepen et al., Cell)

(Elowitz et al., Science)

(Ozbudak et al., Science)

(Balaban et al., Science)

(Jansen & Stumpf, Science)

Monday (11/14): Diversification & coevolution *Avida projects due 11/13 (midnight – to Primrose)

Rachel Whitaker University of Illinois at Urbana-Champaign “A genomic view of microbial diversity in island populations” Thursday, November 10 6PM Location: Center for the Environment (Rm 310) 24 Oxford St, Harvard University, Cambridge Please join us for a wine and cheese reception at 5:30 pm Host: Chris Marx Thursday Noon Seminar Hosted by the FAS Center for Systems Biology “Marvels of bacterial motility” Howard Berg Professor of Physics and Molecular & Cellular Biology Harvard University 12:00pm, Thursday, November 10 Northwest Building, B-103 Lecture Hall 52 Oxford Street, Cambridge