What can sequences tell us? BIOL E-127– 10/15/07.

Slides:

Advertisements

Similar presentations

Codon Bias and Regulation of Translation among Bacteria and Phages

Advertisements

Ortholog vs. paralog? 1. Collect Sequence Data Good Dataset

Orthologs and paralogs Algorithmen der Bioinformatik WS 11/12.

Lateral gene transfer in prokaryotic genomes Uri Gophna Dept. of Molecular Microbiology and Biotechnology, TAU.

T 5/5 exam #3 (bring cheat sheet) Sat. 5/9 optional final exam, 9am-noon.

Detecting HGT: unlikely presence/absence HGT onlyLoss only (Koonin, 2003) Ex: glycerol-3-P DH OEB 192 –

6.4 Manipulating the Genome

Adaptive evolution of bacterial metabolic networks by horizontal gene transfer Chao Wang Dec 14, 2005.

[Bejerano Aut07/08] 1 MW 11:00-12:15 in Redwood G19 Profs: Serafim Batzoglou, Gill Bejerano TA: Cory McLean.

Systems Biology Biological Sequence Analysis

OEB 192 – How follow diversification? MLST for Streptococcus pneumoniae (Fraser et al., 2007) (Feil, 2003)

More on neutral theory OEB 192 – Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.

Detecting HGT: discordant phylogenies OEB 192 –

Photosynthetic genes in cyanophage Lindell et al.PNAS 2004.

First Phylogenetics Assignment: Due Oct 27 th (not Oct. 20 th )

Gene transfer Organismal tree: species B species A species C species D Gene Transfer seq. from B seq. from A seq. from C seq. from D molecular tree: speciation.

Genetic exchange in bacteria/archaea OEB 192 –

1. How does conjugation work? Sex in Bacteria How do bacteria exchange DNA.

Genetic exchange in bacteria/archaea OEB 192 – (Worobey et al., 2010, last Friday)

BIOS E-127 – Phenetics vs. cladistics Lysozyme amino acid changes in unrelated ruminants Phenetics vs. cladistics.

MCB 7200: Molecular Biology

The diversity of genomes and the tree of life

The Microbiome and Metagenomics

Genome projects and model organisms Level 3 Molecular Evolution and Bioinformatics Jim Provan.

Statistical Bioinformatics QTL mapping Analysis of DNA sequence alignments Postgenomic data integration Systems biology.

Genetic transfer and recombination

CAI and the most biased genes Zinovyev Andrei Institut des Hautes Études Scientifiques.

Genomic gigantism in plant mitochondria Andy Alverson.

Genetic exchange Mutations Genetic exchange: three mechanisms

Recombinant DNA Techonology 4.3. Introduction If you pay any attention at all to the news, you cannot avoid stories about biotechnology: sequencing a.

Functional Linkages between Proteins. Introduction Piles of Information Flakes of Knowledge AGCATCCGACTAGCATCAGCTAGCAGCAGA CTCACGATGTGACTGCATGCGTCATTATCTA.

Cells of E. coli bacteria Allow cells to respond to changes in their environment Only make proteins when they are needed.

Prokaryotic vs. eukaryotic genomes. Rocha, E Ann. Rev. Genet. 42: Genome organization in bacteria.

Species Populations Genotypes Valeria Souza & Luis Eguiarte HGT.

Gene & Genome Evolution1 Chapter 9 You will not be responsible for: Read the How We Know section on Counting Genes, and be able to discuss methodologies.

If post is spelled P-O- S-T and most is spelled M-O-S-T, how do you spell the word for what you put in the toaster?

1. How does conjugation work? Sex in Bacteria How do bacteria exchange DNA.

“It is less clear, however, whether our species demarcations provide this information for the vast majority of prokaryotes that are never going to cause.

Evolution Alan Ward. Evolution Formation of the Earth Geochemical dating places the Earth ’ s age at 4.6 billion years The oldest rocks: SW Greenland.

MIMM 502 Honours Mcb/Immunol Calendar courses/mimm502/ 12 credits Info mtg: January 19, 2004, 1200 h Sheldon.

Anis Karimpour-Fard 1, Corrella Detweiler 2, Ryan T. Gill 3, and Lawrence Hunter 1 1 University of Colorado School of Medicine 2 MCD-Biology, University.

Virus, bacteria, and eukaryotic cell (Fig. 18.1).

Functional and Evolutionary Attributes through Analysis of Metabolism Sophia Tsoka European Bioinformatics Institute Cambridge UK.

Figure 18.1 Comparing the size of a virus, a bacterium, and a eukaryotic cell.

Significance Tests for Max-Gap Gene Clusters Rose Hoberman joint work with Dannie Durand and David Sankoff.

Brückner et al., Fig. 1b Brückner et al., Fig. 1B a c b 6 Fig. 1. Circular representation of Streptococcus pneumoniae genome comparisons.

 What is different between these 2 sequences? GGAATTCCTAGCAAT CCTTAAGGATCGTTA CTACGTGAGGAATTC GATGCACTCCTTAAG.

Gene Transfer. Gene transfer in bacteria There are three types of gene transfer 1.Transformation 2.Conjugation 3.Transduction.

Graph partitioning in genomic data analysis Roland Barriot, Petra Langendijk-Genevaux, Yves Quentin, Gwennaele Fichant « Génomique des systèmes intégrés.

Section 26.5: Horizontal Gene Transfer By Monica Macaro.

The rate of evolution Where selection pressures are high, the rate of evolution can be rapid.

The genomic democracy of sex. Genetic variability Mutation Gene flow Sex.

Justin S Hogg et al. {Genome Biology} 2007, 8:R103 Metagenomics Seminar, Spring 2008 Presenter : Kwangmin Choi.

De novo creation of new genes 1.Retrotransposition (+/- cooption of other sequences) AAAAA Pre-mRNA AAAAA Splicing to remove intron Reverse transcription.

Announcements Seminar today after class! Seminar Wednesday!

Molecular Phylogeny Similarity among organisms (and their genes) is the result of descent from a common ancestor. Variation occurs via genetic drift and.

Horizontal gene transfer and the history of life

Personal genome construction

البيئة السياسية للإدارة الدولية

Genome Evolution: Horizontal Movements in the Fungi

Genomics of epidemic pathogens

Genome Evolution: Horizontal Movements in the Fungi

log fraction of singletons

Horizontal gene transfer

Genomic rearrangements of E

Locations of genes that exhibited decreased levels of distribution of the RpoZ-defective RNAP. The genes that showed decreased-level distribution of RpoZ-defective.

Higher Biology Unit 1: 1.7 Evolution.

Diagnostic tools for intestinal pathogenic E. coli.

General overview of the bioinformatic pipelines for the 16S rRNA gene microbial profiling and shotgun metagenomics. General overview of the bioinformatic.

Presentation transcript:

What can sequences tell us? BIOL E-127– 10/15/07

Reconstructed ancestral sequences to infer paleoenvironment (Gaucher et al., 2003)

Signs of selection (Sawyer & Malik, 2006)

Genetic exchange in bacteria/archaea

Detecting HGT: incongruent phylogeny/synteny HGT onlyLoss only (Koonin, 2003) Ex: glycerol-3-P DH

Detecting HGT: formaldehyde metabolism in methylotrophs (Kalyuzhnaya et al., 2005)

Detecting HGT: formaldehyde metabolism in methylotrophs (Kalyuzhnaya et al., 2005)

Detecting HGT: formaldehyde metabolism in methylotrophs Scenarios for pathway evolution (Chistoserdova et al., 2004)

Detecting HGT: plants!?! Rafflesia (Malpighiales) (Davis & Wurdack, 2004)

Detecting HGT: bacteria to insects!?! (Hottop et al., 2007)

HGT genes often clustered (Price et al., 2005)

Detecting HGT from genomes: atypical nt composition (Lawrence & Ochman, 1997)

Detecting HGT from genomes: atypical nt composition (Hacker & Carniel, 2001)

Detecting HGT from genomes: atypical nt composition

(Lawrence & Ochman, 1998)

Detecting HGT from genomes: atypical nt composition (Lawrence & Ochman, 1998)

Detecting HGT from genomes: atypical nt composition

Detecting HGT: differential gene content (Welch et al., 2002) (Pál et al., 2005)

Measurements of natural horizontal gene transfer (HGT) (Sørensen et al., 2005)

Measurements of natural horizontal gene transfer (HGT) (Sørensen et al., 2005)

Limitations to HGT

Decrease in recombination w/ sequence divergence (Fraser et al., 2007) Bacillus subtilis Bacillus mojavensis Streptococcus pneumoniae E. coli