Role of IT in Bioinformatics Naveena.Y
What is bioinformatics ? Study of Information content and information flow in biological systems and processes Definition varies depending upon the domain of person who is giving the definition
What was the reason behind the emergence of a separate domain, bioinformatics ?
Brief History Insulin – 1956 Yeast trna – 1960’s PDB – 1972 Swissprot – 1986 Human Genome Initiated – 1988 Completed – 26 th Jun 2000
Where does the data come from? Wet Lab Research Database 1 Ex : Genbank Database 2 Ex : Swissprot Database 3 Ex : Interpro Publish Primary Secondary Composite
Central Dogma of Life
What is their in each of this? DNA – A,C,T,G RNA – A,C,U,G Protein – AUGACGAGAAGGAGUAGAAGUAG MV Codon Table
Protein Structure Primary Secondary Teritary Quarternary
IT is used in different areas Functional Genomics Proteomics Drug Discovery Plant Biotechnology Molecular Modeling
Challenges Protein Structure Prediction RNA Structure Preditction Drug Discovery Pharmacogenomics
Questions ?