OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical.

Slides:



Advertisements
Similar presentations
Ortholog vs. paralog? 1. Collect Sequence Data Good Dataset
Advertisements

Chapter 17 Table of Contents Section 1 Biodiversity
Tree of Life Chapter 26.
BIOS E “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical.
BIOE 109 Summer 2009 Lecture 4- Part II Phylogenetic Inference.
“Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.
Tree of Life: primary divisions OEB 192 –
BME 130 – Genomes Lecture 26 Molecular phylogenies I.
Phylogenetic Concepts. Phylogenetic Relationships Phylogenetic relationships exist between lineages (e.g. species, genes) These include ancestor-descendent.
More on neutral theory OEB 192 – Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.
BIOS E-127 – Prior theme music: “Evolutionary speculation.
OEB 192 – “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical.
“Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.
BIOS E-127 – Phenetics vs. cladistics Lysozyme amino acid changes in unrelated ruminants Phenetics vs. cladistics.
OEB 192 – “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical.
“Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.
Classification and Phylogenies Taxonomic categories and taxa Inferring phylogenies –The similarity vs. shared derived character states –Homoplasy –Maximum.
Topic : Phylogenetic Reconstruction I. Systematics = Science of biological diversity. Systematics uses taxonomy to reflect phylogeny (evolutionary history).
Phylogeny and the Tree of Life
The diversity of genomes and the tree of life
Systematics The study of biological diversity in an evolutionary context.
Maximum parsimony Kai Müller.
March 3 rd, 2010  Warm Up Open to ch. 17 to follow along with lecture  Today Review Ch. 17 Lab  Homework Study for Ch. 17 exam on Friday.
Prokaryote Taxonomy & Diversity Classification, Nomenclature & Identification Phenetic Classification Molecular Phylogeny Approach Classification (hierarchical.
Chapter 26: Phylogeny and the Tree of Life Objectives 1.Identify how phylogenies show evolutionary relationships. 2.Phylogenies are inferred based homologies.
Computational Biology, Part D Phylogenetic Trees Ramamoorthi Ravi/Robert F. Murphy Copyright  2000, All rights reserved.
3- RIBOSOMAL RNA GENE RECONSTRUCITON  Phenetics Vs. Cladistics  Homology/Homoplasy/Orthology/Paralogy  Evolution Vs. Phylogeny  The relevance of the.
Warm-Up 1.Contrast adaptive radiation vs. convergent evolution? Give an example of each. 2.What is the correct sequence from the most comprehensive to.
Building and visualizing phylogeny Henrik Lantz Dept. of Medical Biochemistry and Microbiology, BMC, Uppsala University.
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece.
Introduction to Phylogenetics
PHYLOGENY AND THE TREE OF LIFE Chapter 26 Sections 1-3 and 6.
Calculating branch lengths from distances. ABC A B C----- a b c.
Chapter 24: Molecular and Genomic Evolution CHAPTER 24 Molecular and Genomic Evolution.
Copyright © by Holt, Rinehart and Winston. All rights reserved. ResourcesChapter menu To View the presentation as a slideshow with effects select “View”
Phylogenies Reconstructing the Past. The field of systematics Studies –the mechanisms of evolution evolutionary agents –the process of evolution speciation.
Phylogeny Ch. 7 & 8.
“Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.
Phylogeny & Systematics
TOK A major step forward in the study of bacteria was the recognition in 1977 by Carl Woese that Archea have a separate line of evolutionary descent.
Ayesha M.Khan Spring Phylogenetic Basics 2 One central field in biology is to infer the relation between species. Do they possess a common ancestor?
Chapter 25: Phylogeny and Systematics. “Taxonomy is the division of organisms into categories based on… similarities and differences.” p. 495, Campbell.
Chapter 26 Phylogeny and Systematics. Tree of Life Phylogeny – evolutionary history of a species or group - draw information from fossil record - organisms.
Phylogeny & Systematics The study of the diversity and relationships among organisms.
Classification, Taxonomy and Patterns of Organization Unit 1.4.
Section 2: Modern Systematics
Phylogeny and the Tree of Life
Phylogeny and the Tree of Life
Phylogeny and Systematics
How to Use This Presentation
Chapter 17 Table of Contents Section 1 Biodiversity
The neutral theory of molecular evolution
Section 2: Modern Systematics
Warm-Up Contrast adaptive radiation vs. convergent evolution? Give an example of each. What is the correct sequence from the most comprehensive to least.
Warm-Up Contrast adaptive radiation vs. convergent evolution? Give an example of each. What is the correct sequence from the most comprehensive to least.
Phylogeny and the Tree of Life
Chapter 17 Table of Contents Section 1 Biodiversity
Warm-Up Contrast adaptive radiation vs. convergent evolution? Give an example of each. What is the correct sequence from the most comprehensive to least.
Warm-Up Contrast adaptive radiation vs. convergent evolution? Give an example of each. What is the correct sequence from the most comprehensive to least.
Phylogeny and Systematics
Chapter 17 Table of Contents Section 1 Biodiversity
Warm-Up Contrast adaptive radiation vs. convergent evolution? Give an example of each. What is the correct sequence from the most comprehensive to least.
Phylogeny and Systematics (Part 6)
Chapter 26- Phylogeny and Systematics
Phylogenetics Chapter 26.
Classification of Organisms
Warm-Up Contrast adaptive radiation vs. convergent evolution? Give an example of each. What is the correct sequence from the most comprehensive to least.
Warm-Up Contrast adaptive radiation vs. convergent evolution? Give an example of each. What is the correct sequence from the most comprehensive to least.
A manifesto for microbial genomics
Ch. 17 Biodiversity Mr. D.
Presentation transcript:

OEB 192 – “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation possessed for some mediaeval scholastics. It can be considered a relatively harmless habit, like eating peanuts, unless it assumes the form of an obsession; then it becomes a vice” (Stanier, 1970)

Tree of Life: primary divisions

Microbial systematics Formerly Pseudomonas (partial list): Ralstonia, Burkholderia, Hydrogenophaga, Sphingomonas, Methylobacterium, Cellvibrio, Xanthomonas, Acidovorax, Hydrogenophillus, Brevundimonas, Pandoraea

16S rRNA as phylogenetic marker Why a good molecule? 70S 30S 50S

Tree of Life: three “domains” Based on 16S rRNA (Woese, 1987):

Tree of Life: three “domains” Based on 16S rRNA (Pace, 1997):

Bacteria & Archaeal: all genomes as of 12 Feb., 2010 (Lee, Robinson & Marx, in prep)

Tree basics: meaning

Tree basics: rotation

Tree basics: shape

Tree basics: character change

Key phylogenetic terms

Phenetics vs. cladistics

Lysozyme amino acid changes in unrelated ruminants Phenetics vs. cladistics

Maximum Parsimony Parsimony – shortest tree (fewest homoplasies)

Neutral theory Developed by Motoo Kimura, 1968

Good Dataset [A1, A2, A3, A4] [A1, B2, A3, A4] Bad Dataset A B species 1 species 2 species 3 species 4 A1 B1 A2 B2 A4 B4 A3 B3 1. Collect Sequence Data Ortholog vs. paralog?

2. Sequence Alignment CGGATAAAC CGGATAGAC CGCTGATAAAC CGGATAC taxa1 taxa2 taxa3 taxa4 Alignment

Wednesday (9/15): Molecular evolution & phylogenetic inference: case of HIV & comment…

Upcoming talks in (microbial) evolution… Wednesday, 9/15 11:00 AM Main Lecture Hall BioLabs Building OEB Weekly Seminar Series Gunter Wagner Yale University Transcription factor protein evolution and the origin of evolutionary novelties Host: Abzhanov Lab