Ras and Cancer Back to where we began: Protein structure combining Bioinformatics, protein structure with Kinemage, and the Map kinase path page

Ras was the first human oncogene found Take DNA from Human bladder cancer cells Put DNA into mouse cells (these cells already had other helpful mutations) Mouse cells become transformed= cancerous Human Ras was found to be the oncogene found in the human bladder cancer cells

We have a ClustalW analysis showing that the number 12 amino acid G (glycine) can be replaced with C (cysteine) and this causes human lung cancer. The normal protooncogene Ras becomes an oncogene

K-Ras can have a point mutation- a single change in the sequence

Oncogenes- Commonly Are from Genes That act in Cell signaling Paths-- Like the Ras Map Kinase path

Our Clustal W analysis of the amino acid change in K Ras From our lab: The number 12 amino acid is different. The First listing is normal, second from cancer patient

Change from normal G to cancerous C-symbolized by G12C. Note no other weird animal has a change (only mutant human protein) No change here in human

Why is there a different amino acid at position 12? The Sequence Manipulation Suite: Show Translation Results for 5312 residue sequence starting "GGCCGCGGCG". 1 A A A A E A A A A A A V A A A K V A A A 1 GGCCGCGGCGGCGGAGGCAGCAGCGGCGGCGGCAGTGGCGGCGGCGAAGGTGGCGGCGGC 21 R P V L P A P A I S D W E R A R R R H * 61 TCGGCCAGTACTCCCGGCCCCCGCCATTTCGGACTGGGAGCGAGCGCGGCGCAGGCACTG 41 R R R R G Q R L S G S Q V R E R G L L K 121 AAGGCGGCGGCGGGGCCAGAGGCTCAGCGGCTCCCAGGTGCGGGAGAGAGGCCTGCTGAA 61 M T E Y K L V V V G A C G V G K S A L T 181 AATGACTGAATATAAACTTGTGGTAGTTGGAGCTTGTGGCGTAGGCAAGAGTGCCTTGAC The normal individual with a protooncogene has GGT not the dangerous TGT DNA coding strand sequence (you do not report the template strand sequence) from a person with cancer due to K Ras mutation…from our prior work Met is 1 st Amino Acid 12 th amino acid is C not G

Use the Genetic Code from our text, for mRNA and an Amino acid For Ras induced cancer, change G (glycine or gly) for a C (cysteine or cys) by changing GGU in mRNA to UGU – only 1 change Fig. 21-8, p 660 in 6 th Ed

GGU or GGC (also GGA or GGG code for glycine) For Cysteine (C) in the mutant oncogene K Ras –the cancer patient would have this sequence in their mRNA: UGU or UGC So, the first nucleotide base of the codon on mRNA changes from a G to a U. This is due to a prior change in the DNA of the cancer patient (a point mutation). In the normal cancer free individual with normal K Ras, the K Ras mRNA with Glycine would have….(using the Genetic Code)

Follow change all the way through …note that the coding strand is always reported (same as mRNA except replace U with T) Coding strand Template strand G changes to T -G-T C changes to A -C-A DNA G changes to U -G-U mRNA Protein #12 Glycine changes to Cysteine And K Ras protein cannot be shut off, causes cancer

Normal protooncogene Oncogene ---GGT CCA GLYCINE GGU TGT ACA UGU--- --CYSTEINE-- DNA coding template mRNA AMINO ACID A POINT MUTATION IN THE DNA; FROM G TO T

Let’s look at Ras structure and see where this number 12 amino acid is located…and why it is so important- Ras is “on” and will cause cell division if the Ras has GTP bound to it (ras is a G Protein) Ras is off when GTP is broken down to GDP. Ras itself breaks down GTP (a GTPase reaction) but Mutant Ras cannot be activated to breakdown GTP. So, mutant Ras stays on…causing cancer (unregulated cell division) Put another way, the mutation inhibits the GTPase activity of Ras

In general, Ras a central Beta sheet and 5 alpha helices located on both sides of the Beta sheet. GTP binds in the end of the Beta sheet

#1 Amino Acid here #12 Glycine In P/G1 loop and helps bind GTP Gly12 here

Use the kinemage Ras file on web site, along with Kinemage, to view Ras structure View1: the backbone of the amino acid chain is in white, the bound GTP analogue in pink, and the Mg++ in yellow View2 is from one edge of the twisted beta sheet of this alpha/beta protein where GTP binds. Glycine 12 (where the most common mutation occurs) and Glycine 13 are labeled in green and are found on what is called the G1 or P loop. These 2 Glycines are located in a critical part of one of the main GTP-binding loops (the G1 or P loop). They are the two major sites of mutations that convert this enzyme into an oncogene - when these Gly's mutate to Cys, the GTP cannot be broken down down (GTPase activity of ras is reduced) so Ras stays in the "on" state more of the time- causing cancer. To see details of interactions at the binding site, choose View3 and turn on "interact.", which shows sidechains in cyan and weak H bonds in purple.