A Very Basic Gibbs Sampler for Motif Detection Frances Tong July 28, 2004 Southern California Bioinformatics Summer Institute.

Slides:

Advertisements

Similar presentations

Gene Regulation and Microarrays. Finding Regulatory Motifs Given a collection of genes with common expression, Find the TF-binding motif in common......

Advertisements

CENTER FOR BIOLOGICAL SEQUENCE ANALYSISTECHNICAL UNIVERSITY OF DENMARK DTU Sequence information, logos and Hidden Markov Models Morten Nielsen, CBS, BioCentrum,

Hidden Markov Models (1)  Brief review of discrete time finite Markov Chain  Hidden Markov Model  Examples of HMM in Bioinformatics  Estimations Basic.

Statistics in Bioinformatics May 2, 2002 Quiz-15 min Learning objectives-Understand equally likely outcomes, Counting techniques (Example, genetic code,

Gapped Blast and PSI BLAST Basic Local Alignment Search Tool ~Sean Boyle Basic Local Alignment Search Tool ~Sean Boyle.

Bioinformatics Motif Detection Revised 27/10/06. Overview Introduction Multiple Alignments Multiple alignment based on HMM Motif Finding –Motif representation.

Regulatory Motifs. Contents Biology of regulatory motifs Experimental discovery Computational discovery PSSM MEME.

1 PharmID: A New Algorithm for Pharmacophore Identification Stan Young Jun Feng and Ashish Sanil NISSMPDM 3 June 2005.

Definitions Optimal alignment - one that exhibits the most correspondences. It is the alignment with the highest score. May or may not be biologically.

Bioinformatics Finding signals and motifs in DNA and proteins Expectation Maximization Algorithm MEME The Gibbs sampler Lecture 10.

Gibbs sampling for motif finding in biological sequences Christopher Sheldahl.

Motif Finding. Regulation of Genes Gene Regulatory Element RNA polymerase (Protein) Transcription Factor (Protein) DNA.

Heuristic alignment algorithms and cost matrices

Finding approximate palindromes in genomic sequences.

Transcription factor binding motifs (part I) 10/17/07.

DNA Regulatory Binding Motif Search Dong Xu Computer Science Department 109 Engineering Building West

Tutorial 5 Motif discovery.

Introduction to Bioinformatics - Tutorial no. 5 MEME – Discovering motifs in sequences MAST – Searching for motifs in databanks TRANSFAC – The Transcription.

Multiple sequence alignments and motif discovery Tutorial 5.

Setting Up a Replica Exchange Approach to Motif Discovery in DNA Jeffrey Goett Advisor: Professor Sengupta.

Biological Sequence Pattern Analysis Liangjiang (LJ) Wang March 8, 2005 PLPTH 890 Introduction to Genomic Bioinformatics Lecture 16.

(Regulatory-) Motif Finding. Clustering of Genes Find binding sites responsible for common expression patterns.

Exploring Protein Sequences Tutorial 5. Exploring Protein Sequences Multiple alignment –ClustalW Motif discovery –MEME –Jaspar.

Lecture 12 Splicing and gene prediction in eukaryotes

CECS Introduction to Bioinformatics University of Louisville Spring 2003 Dr. Eric Rouchka Lecture 3: Multiple Sequence Alignment Eric C. Rouchka,

Motif Refinement using Hybrid Expectation Maximization Algorithm Chandan Reddy Yao-Chung Weng Hsiao-Dong Chiang School of Electrical and Computer Engr.

Motif finding: Lecture 1 CS 498 CXZ. From DNA to Protein: In words 1.DNA = nucleotide sequence Alphabet size = 4 (A,C,G,T) 2.DNA  mRNA (single stranded)

A Statistical Method for Finding Transcriptional Factor Binding Sites Authors: Saurabh Sinha and Martin Tompa Presenter: Christopher Schlosberg CS598ss.

Information theoretic interpretation of PAM matrices Sorin Istrail and Derek Aguiar.

Sequence Alignment and Phylogenetic Prediction using Map Reduce Programming Model in Hadoop DFS Presented by C. Geetha Jini (07MW03) D. Komagal Meenakshi.

Guiding Motif Discovery by Iterative Pattern Refinement Zhiping Wang, Mehmet Dalkilic, Sun Kim School of Informatics, Indiana University.

Content of the previous class Introduction The evolutionary basis of sequence alignment The Modular Nature of proteins.

Gapped BLAST and PSI- BLAST: a new generation of protein database search programs By Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schäffer, Jinghui.

Expectation Maximization and Gibbs Sampling – Algorithms for Computational Biology Lecture 1- Introduction Lecture 2- Hashing and BLAST Lecture 3-

Sequence analysis: Macromolecular motif recognition Sylvia Nagl.

Pairwise Sequence Alignment. The most important class of bioinformatics tools – pairwise alignment of DNA and protein seqs. alignment 1alignment 2 Seq.

Motif finding with Gibbs sampling CS 466 Saurabh Sinha.

Database Searches BLAST. Basic Local Alignment Search Tool –Altschul, Gish, Miller, Myers, Lipman, J. Mol. Biol. 215 (1990) –Altschul, Madden, Schaffer,

Sampling Approaches to Pattern Extraction

Motif discovery Tutorial 5. Motif discovery MEME Creates motif PSSM de-novo (unknown motif) MAST Searches for a PSSM in a DB TOMTOM Searches for a PSSM.

CS5263 Bioinformatics Lecture 20 Practical issues in motif finding Final project.

PreDetector : Prokaryotic Regulatory Element Detector Samuel Hiard 1, Sébastien Rigali 2, Séverine Colson 2, Raphaël Marée 1 and Louis Wehenkel 1 1 Department.

Gibbs Sampler in Local Multiple Alignment Review by 온 정 헌.

Motifs BCH364C/391L Systems Biology / Bioinformatics – Spring 2015 Edward Marcotte, Univ of Texas at Austin Edward Marcotte/Univ. of Texas/BCH364C-391L/Spring.

HMMs for alignments & Sequence pattern discovery I519 Introduction to Bioinformatics.

Bioinformatics Ayesha M. Khan 9 th April, What’s in a secondary database?  It should be noted that within multiple alignments can be found conserved.

Computational Genomics and Proteomics Lecture 8 Motif Discovery C E N T R F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U E.

Guiding motif discovery by iterative pattern refinement Zhiping Wang Advisor: Sun Kim, Mehmet Dalkilic School of Informatics, Indiana University.

Algorithms in Bioinformatics: A Practical Introduction

Gibbs sampling for motif finding Yves Moreau. 2 Overview Markov Chain Monte Carlo Gibbs sampling Motif finding in cis-regulatory DNA Biclustering microarray.

Biocomputation: Comparative Genomics Tanya Talkar Lolly Kruse Colleen O’Rourke.

PROTEIN PATTERN DATABASES. PROTEIN SEQUENCES SUPERFAMILY FAMILY DOMAIN MOTIF SITE RESIDUE.

Cis-regulatory Modules and Module Discovery

EVOLUTIONARY HMMS BAYESIAN APPROACH TO MULTIPLE ALIGNMENT Siva Theja Maguluri CS 598 SS.

Multiple Species Gene Finding using Gibbs Sampling Sourav Chatterji Lior Pachter University of California, Berkeley.

Local Multiple Sequence Alignment Sequence Motifs

Learning Sequence Motifs Using Expectation Maximization (EM) and Gibbs Sampling BMI/CS 776 Mark Craven

Construction of Substitution matrices

Special Topics in Genomics Motif Analysis. Sequence motif – a pattern of nucleotide or amino acid sequences GTATGTACTTACTATGGGTGGTCAACAAATCTATGTATGA TAACATGTGACTCCTATAACCTCTTTGGGTGGTACATGAA.

Chapter 6 - Profiles1 Assume we have a family of sequences. To search for other sequences in the family we can Search with a sequence from the family Search.

HW4: sites that look like transcription start sites Nucleotide histogram Background frequency Count matrix for translation start sites (-10 to 10) Frequency.

Motif identification with Gibbs Sampler Xuhua Xia

Finding Motifs Vasileios Hatzivassiloglou University of Texas at Dallas.

1 Discovery of Conserved Sequence Patterns Using a Stochastic Dictionary Model Authors Mayetri Gupta & Jun S. Liu Presented by Ellen Bishop 12/09/2003.

A Very Basic Gibbs Sampler for Motif Detection

Gibbs sampling.

Motifs BCH364C/394P - Systems Biology / Bioinformatics

Learning Sequence Motif Models Using Expectation Maximization (EM)

(Regulatory-) Motif Finding

Motifs BCH339N Systems Biology / Bioinformatics – Spring 2016

Presentation transcript:

A Very Basic Gibbs Sampler for Motif Detection Frances Tong July 28, 2004 Southern California Bioinformatics Summer Institute

What? What is a motif? What is the biological point? What is the goal? What is a limitation with dynamic programming? What is Gibbs sampling? What is the program going to do? What is the program missing? What is a much better program?

What is a motif? A motif is a sequence pattern that occurs repeatedly in a group of related dna or protein sequences.

What is the biological point? Encoding the “structural motif” of a protein (dna in exons) Prediction of function (protein) Protein binding sites (dna) Transcription binding factors

What is the goal? Perform local multiple sequence alignment to find consensus sequences (motifs)

What is a limitation with dynamic programming? Memory and time complexity issues Size of search space = (L-W+1)^N L = length of a sequence W = width of motif N = number of sequences ex: L=30, W=7, N=10 ( )^10 = Alignment of even four such sequences will take a few hours ~10^4 seconds

What is Gibbs sampling? Stochastic optimization method Works well with local multiple alignment without gaps (motif searching) Searches for the statistically most probable motifs by sampling random positions instead of going through entire search space

What is the program going to do? 1. Ask user for : a) file containing multiple dna or protein sequences b) motif width c) how many motifs wanted 2. Calculate the background frequencies of A,C,G,T from all the sequences. [ , , , ]

What is the program going to do? 3. Generate random start positions for the motif in each sequence. ex: 10 sequences, 30 bp in length, motif width of 7 start = [2, 6, 9, 14, 5, 7, 20, 20, 6, 22] >> random.uniform(0,ceiling) where ceiling=len(sequence)-width

What is the program going to do? 4. Construct position specific score matrix from all sequences except one. Motif Position A C G T

What is the program going to do? 5. Score the left-out sequence according to the position specific score matrix:

What is the program going to do? Example: Use the position specific matrix and background from before: [A: , C: , G: , T: ] Motif Position A C G T GATTACA:

What is the program going to do? 6. Randomly generate another start position of the motif for that left-out sequence. 7. Score that sequence with its new start position. 8. Compare this new score with its original score. 9. If newscore >= oldscore, then jump to that new start position, else jump to that new start position with probability =

What is the program going to do? 10. Start all over again with this updated start position with another sequence left out Do this many many times! ~ 1000 iterations Gibbs will converge to a stationary distribution of the start positions => a probable alignment of the multiple sequences

What is the program missing? Doesn’t do reinitializations in the middle to get out of local maxima Doesn’t optimize the width (you have to specify width explicitly) Doesn’t do the Bayesian approach – just frequentist (easier for me and for you to understand!) Doesn’t read in fasta files Doesn’t do error checking! And other things that don’t know they are missing yet!

What is a much better program? Gibbs Motif Sampler bs.html bs.html AlignAce bin/alignace.pl bin/alignace.pl

That’s it!