Next generation read mapping on GPUs Cole Trapnell
Next gen sequencing Solexa/Illumina, AB SOLiD, etc produce many short (25-50bp) sequencing reads. Need to map these back to a reference genome
GPGPU Programming Previously wrote MUMmerGPU with Mike Schatz Finds exact substring matches between reads and a reference using the graphics card Reads mapped in parallel with CUDA
Landau-Vishkin aaattcct-ttagacccattttagcccttca ||||X||| |||||||||||||||||||||| aaattcctcttagacccattttagcccttca
Streaming reads and reference All Reads For each read: 1.Find all exact substring matches ≥ l on the GPU 2.Filter matches to discard redundant ones 3.Extend exact matches left and right to obtain inexact alignments 4.Report end to end inexact alignments Align all reads to a sliding window of the reference