How follow diversification? MLST for Streptococcus pneumoniae (Fraser et al., 2007) (Feil, 2003) OEB 192 – 09.09.23.

Slides:

Advertisements

Similar presentations

Clostridium difficile Colitis or Dysbiosis. Symbiostasis/Dysbiosis.

Advertisements

Genetic Statistics Lectures （５） Multiple testing correction and population structure correction.

Ortholog vs. paralog? 1. Collect Sequence Data Good Dataset

On board do traits fit B.M. model? can we use model fitting to answer evolutionary questions? pattern vs. process table.

$100 $200 $300 $400 $500 $100 $200 $300 $400 $500 $100 $200 $300 $400 $500 $100 $200 $300 $400 $500 $100 $200 $300 $400 $500 $100 $200 $300.

“Everything is everywhere – the environment selects.” (Baas-Becking, 1934) “Although there is no direct effect of distance per se, distance is related.

Detecting HGT: unlikely presence/absence HGT onlyLoss only (Koonin, 2003) Ex: glycerol-3-P DH OEB 192 –

OEB 192 – Evolution of pathogens (Grenfell et al., 2004)

BIOS E-127 – Microbial species, biogeography & population genetics.

OEB 192 – Mobile genetic elements and adaptive mutation.

OEB 192 – Phenotypic diversity & epigenetics.

OEB 192 – Evolution of pathogens (Grenfell et al., Science)

What can sequences tell us? BIOL E-127– 10/15/07.

OEB 192 – Phenotypic diversity & epigenetics.

OEB 192 – Phenotypic diversity & epigenetics.

ACTIVITY 2: SIZE AND SCALE MATTER! Original drawings by John Tenniel.

BioGENESIS highlighted points from the annual report Dan Faith, Tet Yahara.

OEB 192 – How follow diversification? MLST for Streptococcus pneumoniae (Fraser et al., 2007) (Feil, 2003)

More on neutral theory OEB 192 – Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.

Detecting HGT: discordant phylogenies OEB 192 –

OEB 192 – Phenotypic diversity & epigenetics.

First Phylogenetics Assignment: Due Oct 27 th (not Oct. 20 th )

A dynamic program algorithm for haplotype block partitioning Zhang, et. al. (2002) PNAS. 99, 7335.

Genetic exchange in bacteria/archaea OEB 192 –

OEB 192 – Epistasis. (Segrè et al., Nat. Genet.)

The phylogenetics project data revealed! October 4, 2010 BIOS E-127.

BIOS E-127 – Diversification & co-evolution.

BIOS E-127 – Phenetics vs. cladistics Lysozyme amino acid changes in unrelated ruminants Phenetics vs. cladistics.

MATH 310, FALL 2003 (Combinatorial Problem Solving) Lecture 21, Wednesday, October 22.

Species “Species are groups of actually or potentially interbreeding populations, which are reproductively isolated from other such groups” (Mayr, 1942)

The phylogenetics project data revealed! October 4, 2010 OEB 192.

Species “Species are groups of actually or potentially interbreeding populations, which are reproductively isolated from other such groups” (Mayr, 1942)

BIO 411 – Medical Microbiology Chapter 9 Commensal and Pathogenic Microbial Flora.

Sebastian Suerbaum & Christine Josenhans

$100 $200 $300 $400 $500 $100 $200 $300 $400 $500 $100 $200 $300 $400 $500 $100 $200 $300 $400 $500 $100 $200 $300 $400 $500 $100 $200 $300.

Miracles can be achieved by mixture modelling of messy data.. Chromopainter/FineSTRUCTURE/Globetrotter.

Biodiversity hotspots of primary producers at the global scale Alice Soccodato In collaboration with: d’Ovidio F, De Monte S, Levy M, Follows M, Alvain.

“It is less clear, however, whether our species demarcations provide this information for the vast majority of prokaryotes that are never going to cause.

Geographic variations in microbial cytometric diversity

Introduction to Microbiology Chapter 1. I. Objectives u Why microbiology? u What is a microbe? u How did we learn all this?

Microbial Genetics - Mutation l Mutation - Introduction –A mutation is a change in the DNA sequence that results in a change in the product protein –Mutations.

Compositionality and Sparseness in 16S rRNA data Anthony Fodor Associate Professor Bioinformatics and Genomics UNC Charlotte.

How to study adaptation? Design – optimality theory Experiment –Track success of different phenotypes –Manipulate phenotype Comparative method –Test an.

HAPPY TUESDAY Bellwork: On your bellwork sheet write “Mosst Missed Quiz and Fill in KWL Chart”. On the “Natural Selection Video Guide” Handout, fill in.

Happy (198 th ) birthday Chucky D.!!!. Mutations are random Luria & Delbrück experiment (1943)

HAPPY THURSDAY F3 Computer BELLWORK: Explain in 32 words what is happening in this PEDIGREE comparing long-necked giraffes vs short-necked giraffes.

Evolution of Biodiversity. Diversity of Species Biodiversity a. ecosystem diversity b. species diversity c. genetic diversity.

Ms. Hughes.  Evolution is the process by which a species changes over time.  In 1859, Charles Darwin pulled together these missing pieces. He was an.

713 Lecture 1 Microbial biogeography and diversity.

Justin S Hogg et al. {Genome Biology} 2007, 8:R103 Metagenomics Seminar, Spring 2008 Presenter : Kwangmin Choi.

Gaurav Arora 1, Vinayak Mathur 2, and Anne Rosenwald 2 1 Gallaudet University, Department of Science, Technology, and Mathematics, Washington, DC

Evolution, Biodiversity, & Population Ecology

Darwin’s only figure in “The Origin of Species” (1859)

The mechanisms that regulate systemic resilience in humans and animals

Darwin’s only figure in “The Origin of Species” (1859)

Genome Evolution: Horizontal Movements in the Fungi

Demonstration of Helicobacter pylori by the four staining methods: (A) modified Giemsa, (B) anti-H pylori antibody immunostain, (C) modified McMullen's.

Genome Evolution: Horizontal Movements in the Fungi

Latitudinal gradient and distribution of species richness

Chapter 9 Microbes and Plants Dodds & Whiles ©2010 Elsevier, Inc.

OTU and beta-diversity novelty.

F. Mégraud, P. Lehours, F.F. Vale Clinical Microbiology and Infection

Label frequency and average enrichment of taxa.

Sampling locations and IDs for accessions sequenced in this study.

Cyanophage-host interactions from metatranscriptomic data.

Gut Microbiome Studies

Neonatal HSV-2 genomes are genetically distinct from one another and encompass a broad range of known HSV-2 genetic diversity. Neonatal HSV-2 genomes are.

Beta-diversity analyses of microbial taxa recovered from ATM keypads.

Phylogenetic trees of S. oralis and S. mitis strains.

Presentation transcript:

How follow diversification? MLST for Streptococcus pneumoniae (Fraser et al., 2007) (Feil, 2003) OEB 192 –

Population genetic structure from MLST modest HGT high HGT (Feil, 2004)

“Everything is everywhere – the environment selects.” (Baas-Becking, 1934) Microbial biogeography

Diversity vs. distance (Cho & Tiedje, 2000)

Diversity vs. distance (Cho & Tiedje, 2000)

Non-random distributions of free-living taxa (Hughes Martiny et al., 2006)

Microbes in a host w/ biogeography: Helicobacter pylori (Falush et al.,2003)

Single rule may not always apply (Nesbø et al., 2006)

Speciation through time

Monday (9/28): *Guest lecture: selection upon codons **Turn in phylogenetics project