An Exploratory Method to Reconstruct Pathways Cory Tobin.

Slides:

Advertisements

Similar presentations

Annotation of Gene Function …and how thats useful to you.

Advertisements

Genome databases and webtools for genome analysis Become familiar with microbial genome databases Use some of the tools useful for analyzing genome Visit.

Doug Raiford Lesson 13 5/10/20151Gene networks and pathways.

CSE Fall. Summary Goal: infer models of transcriptional regulation with annotated molecular interaction graphs The attributes in the model.

1 Modularity and Community Structure in Networks* Final project *Based on a paper by M.E.J Newman in PNAS 2006.

ProInt Finder to Search Protein Interactions Shwe S. Lin Mentor: Matteo Pellegrini, UCLA.

KEGG: Kyoto Encyclopedia of Genes and Genomes Susan Seo Intro to Bioinformatics Fall 2004.

Basis State Prediction of Cell-Cycle Transcription Factors in Saccharomyces cerevisiae Dr. Matteo Pellegrini Dr. Shawn Cokus Sherri Rose UCLA Molecular,

Development of High-throughput Screening Assay for Small Molecule Inhibitor(s) of PIAS1 Bourns College of Engineering Department of Bioengineering Vicente.

Introduction to Bioinformatics - Tutorial no. 13 Probe Design Gene Networks.

Protein-protein interactions

ONCOMINE: A Bioinformatics Infrastructure for Cancer Genomics

Use of Ontologies in the Life Sciences: BioPax Graciela Gonzalez, PhD (some slides adapted from presentations available at

Systems Biology Biological Sequence Analysis

The Wold Lab BioHub Cory Tobin. Collaborators Brandon King Joe Roden Diane Trout Dr. Barbara.

August 29, 2002InforMax Confidential1 Vector PathBlazer Product Overview.

Graph, Search Algorithms Ka-Lok Ng Department of Bioinformatics Asia University.

Protein-protein Interactions Hsueh-Fen Juan 2003, Mar 31 NTNU.

Data Mining Presentation Learning Patterns in the Dynamics of Biological Networks Chang hun You, Lawrence B. Holder, Diane J. Cook.

Evaluation of Signaling Cascades Based on the Weights from Microarray and ChIP-seq Data by Zerrin Işık Volkan Atalay Rengül Çetin-Atalay Middle East Technical.

Class Projects. Future Work and Possible Project Topic in Gene Regulatory network Learning from multiple data sources; Learning causality in Motifs; Learning.

Introduction to molecular networks Sushmita Roy BMI/CS 576 Nov 6 th, 2014.

Signaling Pathways and Summary June 30, 2005 Signaling lecture Course summary Tomorrow Next Week Friday, 7/8/05 Morning presentation of writing assignments.

Marcotte EM, Pellegrini M, Ng HL, Rice DW, Yeates TO, Eisenberg D. (1999). Detecting protein function and protein-protein interactions from genome sequences.

Affinity chromatography/mass spec Bait protein GST Page 252.

Modeling Functional Genomics Datasets CVM Lessons 4&5 10 July 2007Bindu Nanduri.

341: Introduction to Bioinformatics Dr. Natasa Przulj Deaprtment of Computing Imperial College London

Ch10. Intermolecular Interactions and Biological Pathways

Metagenomic Analysis Using MEGAN4

Functional Linkages between Proteins. Introduction Piles of Information Flakes of Knowledge AGCATCCGACTAGCATCAGCTAGCAGCAGA CTCACGATGTGACTGCATGCGTCATTATCTA.

Overview  Introduction  Biological network data  Text mining  Gene Ontology  Expression data basics  Expression, text mining, and GO  Modules and.

Protein analysis and proteomics (Part 2 of 2). Many of the images in this powerpoint presentation are from Bioinformatics and Functional Genomics by Jonathan.

Synthetic biology: New engineering rules for emerging discipline Andrianantoandro E; Basu S; Karig D K; Weiss R. Molecular Systems Biology 2006.

Bioinformatics Dr. Víctor Treviño BT4007

EGAN: Exploratory Gene Association Networks by Jesse Paquette Biostatistics and Computational Biology Core Helen Diller Family Comprehensive Cancer Center.

Gene Regulatory Network Inference. Progress in Disease Treatment  Personalized medicine is becoming more prevalent for several kinds of cancer treatment.

Tutorial on Current Biochemical Pathway Visualization Tools By Rana Khartabil.

I529: Lab5 02/20/2009 AI : Kwangmin Choi. Today’s topics Gene Ontology prediction/mapping – AmiGo –

Network & Systems Modeling 29 June 2009 NCSU GO Workshop.

CZ5225 Methods in Computational Biology Lecture 9: Biological pathways and pathway simulation Prof. Chen Yu Zong Tel:

A Method for Protein Functional Flow Configuration and Validation Woo-Hyuk Jang 1 Suk-Hoon Jung 1 Dong-Soo Han 1

Computational Construction of Intra-Cellular Networks Tolga Can Associate Professor Department of Computer Engineering Middle East Technical University.

Information in Biology. Outline What is synthetic biology? Biological Clocks The “Repressilator” Signal transduction The “Diverter”

A Biology Primer Part IV: Gene networks and systems biology Vasileios Hatzivassiloglou University of Texas at Dallas.

Bioinformatics lectures at Rice University Li Zhang Lecture 9: Networks and integrative genomic analysis

Biological Signal Detection for Protein Function Prediction Investigators: Yang Dai Prime Grant Support: NSF Problem Statement and Motivation Technical.

NY Times Molecular Sciences Institute Started in 1996 by Dr. Syndey Brenner (2002 Nobel Prize winner). Opened in Berkeley in Roger Brent,

The Mammalian Protein – Protein Interaction Database and Its Viewing System That Is Linked to the Main FANTOM2 Viewer Genome Research (2003) Speaker: 蔡欣吟.

PPI team Progress Report PPI team, IDB Lab. Sangwon Yoo, Hoyoung Jeong, Taewhi Lee Mar 2006.

GeWorkbench John Watkinson Columbia University. geWorkbench The bioinformatics platform of the National Center for the Multi-scale Analysis of Genomic.

Functional and Evolutionary Attributes through Analysis of Metabolism Sophia Tsoka European Bioinformatics Institute Cambridge UK.

Extracellular signal molecule

Introduction to biological molecular networks

A database of biological pathways and processes (borrowed from a presentation created by Steve Jupe)

JAK-STAT Signaling Pathway.

Discovering functional interaction patterns in Protein-Protein Interactions Networks   Authors: Mehmet E Turnalp Tolga Can Presented By: Sandeep Kumar.

The Future of Genetics Research Lesson 7. Human Genome Project 13 year project to sequence human genome and other species (fruit fly, mice yeast, nematodes,

Reconstructing the metabolic network of a bacterium from its genome: the construction of LacplantCyc Christof Francke In silico reconstruction of the metabolic.

Pathway Ranking Tool Dimitri Kosturos Linda Tsai SoCalBSI, 8/21/2003.

Tools in Bioinformatics Ontologies and pathways. Why are ontologies needed? A free text is the best way to describe what a protein does to a human reader.

Javad Jamshidi Fasa University of Medical Sciences, November 2015 Genes, Genomes and Chromatin Organization.

PROTEIN INTERACTION NETWORK – INFERENCE TOOL DIVYA RAO CANDIDATE FOR MASTER OF SCIENCE IN BIOINFORMATICS ADVISOR: Dr. FILIPPO MENCZER CAPSTONE PROJECT.

Simultaneous identification of causal genes and dys-regulated pathways in complex diseases Yoo-Ah Kim, Stefan Wuchty and Teresa M Przytycka Paper to be.

BCB 570 Spring Signal Transduction Julie Dickerson Electrical and Computer Engineering.

Networks and Interactions

Pathway Analysis June 13, 2017.

Genome Biology & Applied Bioinformatics Mehmet Tevfik DORAK, MD PhD

Bioinformatics Capstone Project

Bioinformatics, Vol.17 Suppl.1 (ISMB 2001) Weekly Lab. Seminar

Pathway Analysis July 9, 2019.

Presentation transcript:

An Exploratory Method to Reconstruct Pathways Cory Tobin

Collaborators Dr. Matteo Pellegrini Shawn UCLA

Outline Purpose Methods Sample Data Possible Uses Final Remarks

Purpose Reconstruct signal transduction pathways & protein complexes using protein-protein interactions reported on the web

Materials Python Yahoo! Search API ProstgreSQL Django Web Framework

Methods Construct high likelihood / low noise queries Ex: “Jak2 phophorylates Stat5” Query Yahoo! for every permutation of 2 proteins in a given species Use high likelihood joining words…

Joining Words Phosphorylates Methylates Acetylates Activates Deactivates Binds to Inhibits Dephosphorylates Glycosylates Ubiquitinates Interacts with

Full Query “Jak2 acetylates OR phosphorylates OR methylates OR binds to OR interacts with Stat5”

Hindrance Doing pair-wise queries for all N proteins in an organism requires N*N queries E. coli has >4000 genes (16,000,000 queries) Yahoo! allows 5k / day / computer

Possible Solutions Recruit 4k computers and finish in a day Find a better method OR

Better Method Only specify the first symbol Iterate through the results and only take results whose word following the joining symbol corresponds to a valid symbol

Full Query “Jak2 acetylates OR phosphorylates OR methylates OR binds to OR interacts with”

Another Hindrance The symbol “thE” (and others like it) Searches need to be case insensitive to account for “p53” and “P53” Recognizes the word “the” as the protein “thE”

Solution Use a list of stop words Very common, non-interesting words If the name appears in that list of stop words, just forget about that protein all together

Methods (cont.) After we have this data in a database... Create a web interface to the data so others can search for protein interactions (Shwe)

Data KEGG - Yeast MAPK Our Data

Data (cont.) KEGG - Yeast Cell Cycle Our Data

Data (cont.) KEGG - Yeast 26S Proteasome Our Data

Possible Uses General reference for protein interactions Curate other databases

Final Remarks Only works well detecting signal pathways and protein complexes Not metabolic pathways It is possible to get high quality, interesting data without much noise or complex text analysis algorithms

References Kyoto Encyclopedia of Genes and Genomes Cytoscape Network Visualization Yahoo! Developer Network

Acknowledgements Dr. Matteo Pellegrini Everyone in the lab SoCalBSI NIH / NSF