An example story OEB 192 10.09.01 (Nature 394:69-72)

Slides:



Advertisements
Similar presentations
Palazzo-Hospitality Parlor Type A
Advertisements

April 2-4, 2014 – Saratoga Springs, NY Corporate Learning LAB & Symposium Set #1 Slides O M O C s ?
Swim Lessons Fall 2008 Please call for private lessons or lessons for children with special needs. We will do our best to accommodate your requests and.
BIOS E-127– Evolution of pathogens (Grenfell et al., 2004)
BIOS E-127 – Evolution of digital organisms.
OEB 192 – Tradeoffs, specialization & pleiotropy.
An example story OEB (Nature 394:69-72)
OEB 192 – Phenotypic diversity & epigenetics.
OEB 192 – Phenotypic diversity & epigenetics.
OEB 192 – Phenotypic diversity & epigenetics.
Earth Sciences Contact: Dept Office The Department Office is open 9:00am until 5:00pm Monday - Friday.
More on neutral theory OEB 192 – Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.
OEB 192 – Optimality & evolution of networks.
Evolution before Darwin Lamarck: Philosophie Zoologique (1809) OEB 192 – Prior theme music:
Genetic exchange in bacteria/archaea OEB 192 –
BIOS E-127 – Evolution of microbes. An example story BIOS E-127 – (Nature 394:69-72)
“Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.
OEB 192 – Epistasis. (Segrè et al., Nat. Genet.)
Saturday May 02 PST 4 PM. Saturday May 02 PST 10:00 PM.
Genetic exchange in bacteria/archaea OEB 192 – (Worobey et al., 2010, last Friday)
BIOS E-127 – Diversification & co-evolution.
MONDAYTUESDAYWEDNESDAYTHURSDAYFRIDAYSATURDAYSUNDAY WEEK WEEK WEEK WEEK WEEK CALENDAR PROJECT.
Flight Traveling By Emily. Surabaya – Auckland Departure time: Monday, September 29 th at 3:00 a.m. Length of flight: 9 hours and 16 minutes Auckland.
Upcoming Dates for 2014 Jan 7 th : First Meeting of 2013 March 29 th : Wine and Cheese April 4 th & 5 th : Central Atlantic Meeting & College Bowl April.
What day is today? What`s the date?. Sunday Monday Tuesday Wednesday Thursday Friday Saturday What day is today?
History Warm-Ups Week # 34 Dates : May Monday: (Count down 6 lines and draw a line) _______________________________________________________________________________.
Lincoln Middle School Announcements for Friday, October 18, 2013.
Skills for Academic Success
If you would like to donate cookies for Coffee Fellowship, please see Pat Shipley.
Dates to mark on your summer calendar August 23 – Annual Rummage Sale. Set up starts August 21 with take down through August 25 August 24 – Message and.
IT CLUB – ACM CHAPTER Association for Computing Machinery.
Welcome to Reception Parents’ information evening 18 th June 2015.
September 20, 2012 Please get the following: a handout from the counter a textbook your vocabulary words so we can review a writing utensil.
The King Comes to Us St. Peter Worship at Key to Life Saturday, March 23rd.
Easter Revision Sessions Monday 14 April English Tuesday 15 April GCSE French 9.00 am – pm – Room 22 GCSE Photography am – 3.00 pm Wednesday.
District 8 AALAS 2014 Meeting Check out for more details! Submission Deadline: Friday, January 30, 2014.
/edit 1.
Garside: SNC2D. The following schedule is for Period 2 Class:
Ghost Story Requirements In the tradition of Mary Shelley…
All Year Groups. Clubs Seniors Volleyball Club Miss Dickman Tonight 3.00pm S5/6 only PE Dept.
Kelowna Secondary Grade 10/11 Parent Ambassadors December 5 th, 2013.
Contacts During sessions: Out of hours : Welcome to our December 2015 Newsletter Newsletter.
2012. Key Dates April 23 rd Setup begins April 25 th – 5:30pm THE PARTY volunteer meeting May 2 nd – 11:00 Volunteer Meeting Wednesday, May 9 th THE PARTY.
OEB 192 – Dynamics of adaptation.
Mrs. Bocook’s Contact information: phone: (606)
An example story BIOL E-127 – 9/24/07 (Nature 394:69-72)
PeriodTimeMinutes 3 rd Period8:00 – 8: rd Period8:45 – 10:1590 Break10:15 – 10: th Period10:30 – 11: th Period11:10 – 12:4090 PeriodTimeMinutes.
WeekDateTimeVenueCast calledNotes 1Tuesday Jan 5 th Wednesday Jan 6 th 7:30 – 10:00pm 7:00- 10:00pm Wroughton Parish Church Hall Methodist Church Principals.
Monday October 5, 2015 WARM-UP: QUESTION #1 WEEK OF OCT 5 QUESTION - DESCRIBE HOW THE RESPIRATORY SYSTEM AND THE CIRCULATORY SYSTEM WORK TOGETHER. Unit.
Sunday Sunday April 14 th April 14 th. Today’s message is available for sale after service. $5 per CD See Audio Department to get your copies.
Employee Campaign Managers - You can download and use these templates for various fundraising events to support your United Way workplace campaign. Just.
NSSLHA Meeting September 11th Inspiration Clip Boy hears father’s voice for the first time GA9gEh1fLs#
By Jayson Park. Goals Navigate to prototype Create a Reservation Navigate to Wednesday 11/9 Make a reservation at 4:00PM to 6:00 PM for room L1108 View.
By Jayson Park. Goals Navigate to prototype Navigate to Wednesday 11/9 Create Reservation at 4:00PM to 6:00 PM Remove reservation View Current Appointments.
© NHS Institute for Innovation and Improvement, 2012 Presentation title: 32pt Arial Regular, black Recommended maximum length: 1 line © NHS Institute for.
Need Help With Trig graphs? Then this workshop is for YOU! Where: MS109 When: Wednesday March 16 th and Thursday March 17 th When: 11:30 – 12:30 All Math.
Dates for Stop Smoking Courses 2013
Presentation Title Xfinity Standard Light 36pt
“Stem Cells and Cancer”
SCHOOL, DEPARTMENT, PROGRAM, OR OTHER TEXT IF NEEDED
Please send any images as a separate file
September 3-7, 2017 Mathematics Language Arts
Saint Mary of the Assumption High School Invites All Freshmen, Sophomores, Juniors and Seniors to the Student Class Officer Interest Meeting When:
Title to go here Subtitle to go here.
Room 15 News & Notes September 17 – 21, 2018
Type your presentation title here
Date Session Title Name Organization.
Speaker name Title Title
Speaker name Title Title
Presentation transcript:

An example story OEB (Nature 394:69-72)

Experimental design

Diversity observed in still medium in 7 days

Diversity & cell counts over time in each environment StillShaken

Maintenance of high diversity requires continued heterogeneity shaken still shaken still

Fitness of each is ‘frequency-dependent’

For Wednesday (9/8) *No meeting on Labor Day, 9/6…

MSI Chalktalk Breakfast Friday, Sept 3 8:45-9:30 am “Can we cultivate the uncultivable?” Peter Girguis Organismic & Evolutionary Biology Please join us for coffee/tea/pastries at 8:30 am - Directions to 24 Oxford St: -Join MSI-news listserv: and in the body of your , copy the text: subscribe MSI Seminar Date: Thursday, September 9 th Time: 5:30 – 6:00PM wine & cheese reception, 6:00 – 7:00PM seminar Title: Life between the Snowballs Speaker: Tanja Bosak (MIT) Location: HUCE Seminar Room 24 Oxford St, 3 rd Floor, Room 310

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2025 SlidePlayer.com. Inc. All rights reserved.