基因與蛋白質資料庫 阮雪芬 Nov 20 & 27, 2002 NTU

Index Genome Sequence searching Cutting site for a specific sequence Restriction Mapper REBASE REBsite NEB cutter v1.0 DARWIN Sequence Alignment NCBI BLAST Pairwise BLAST Search for conserved domains ORF Finder BGSS Proteome Protein primary structure Amino acid and atomic composition Computing pI and MW Sequence searching Sequence alignment DNA translate to protein Protein-protein interaction on the web YPLMD GeneScape YIPD BIOCARTA

Outline Introduction to genomics Gene Sequence Searching Cutting Site for a Specific Sequence Sequence Alignment Search for Conserved Domains ORF Finding Genomics

Ribose and Deoxyribose

Backbone of DNA and RNA

Purines and Pyrimidines

Watson-Crick Base Pairs

Watson-Crick Model of Double Helical DNA

Biochemical Context of Genomics and Proteomics DNA mRNA Proteins Cell functions Genome “ Genomics ” Proteome “ Proteomics ”

DNA 和蛋白質合成的地方 DNA Proteins Sugar Chain cytoplasm

Genome Gene + Chromosome Genome

Gene Sequence Searching Accession Number Gene Sequence

Gene Sequence Searching AA AA AA AA AA

Gene Sequence Searching

GGGGGGGGGAAGCTGAGCGCTGAGACCAAGGGCTAAAGCTGGGAGACTGAAAAAATGCAG ACCGCCGGGGCATTATTCATTTCTCCAGCTCTGATCCGCTGTTGTACCAGGGGTCTAATC AGGCCTGTGTCTGCCTCCTTCTTGAATAGCCCAGTGAATTCATCTAAACAGCCTTCCTAC AGCAACTTCCCACTCCAGGTGGCCAGACGGGAGTTCCAGACCAGTGTTGTCTCCCGGGAC ATTGACACAGCAGCCAAGTTTATTGGTGCTGGGGCAGCCACAGTTGGTGTGGCTGGTTCA GGGGCTGGCATTGGAACCGTGTTTGGCAGCTTGATCATTGGCTATGCCAGGAACCCGTCT CTCAAGCAGCAGCTCTTCTCCTATGCCATTCTTGGCTTTGCCCTGTCTGAGGCCATGGGG CTTTTCTGTTTGATGGTCGCCTTCCTCATCCTCTTCGCCATGTGAGGCTCCATGGGGGGT CACCGGCCTGTTGCTACTGCAACTCCACACCATTCTTGGTGCTGGGGTGTGTTAAGCTTT ACCATTAAACACAACGTTTCTCTAAAAAAAAAAAAAAAAAAAAC

Cutting Site for a Specific Sequence Sequence Cut by Restriction Enzymes 1.RestrictionMapper 2.REBASE 3.DARWIN

Cutting Site for a Specific Sequence RestrictionMapper

RestrictionMapper

REBASE Rebase.neb.com/rebase.html

DARWIN RE.html

Sequence Alignment Input Query Amino Acid Sequence DNA Sequence Blastptblastn blastn blastxtblastx Compares Against protein Sequence Database Compares Against Translated Nucleotide Sequence Database Compares Against Nucleotide Sequence Database Compares Against protein Sequence Database Compares Against Translated Nucleotide Sequence Database

Pairwise BLAST

BLAST NCBI:

Copy Sequence

Search for Conserved Domains

ORF Finder (Open Reading Frame Finder)

BGSS (Gene Function Search System) AA AA AA AA AA

BGSS

Outline Introduction to proteomics Primary Structure Analysis Protein Sequence Searching Protein Sequence Alignment DNA Translate to Protein Protein-protein Interactions Useful Bio-websites Proteomics

What Is Proteomics ?

Proteomics Protein +Genome  Proteome Proteome  Proteomics

How Proteomics Can Help Drug Development

Definitions of Proteomics First coined in 1995 Be defined as the large-scale characterization of the entire protein complement of a cell line, tissue, or organism. Goal: -To obtain a more global and integrated view of biology by studying all the proteins of a cell rather than each one individually.

Proteomics Origins In 1975, the introduction of the 2D gel by O’Farrell who began mapping proteins from E. coli. The first major technology to emerge for the identification of proteins was the sequencing of proteins by Edman degradation  picomole MS technology has replaced Edman degradation to identify proteins  femtomole

Types of Proteomics and Their Applications to Biology

Two-dimensional Gel Approach Nature 2000, 405,

Standard Proteome Analysis by 2DE-MS Current Opinion in Chemical Biology 2000, 4:489–494 Mass Fingerprint Searching in ych/tools/peptide nt.html

Primary Structure Analysis Object: To compute the characters of proteins. -Amino acid composition -Atomic composition -pI -Molecular weight

Amino Acid & Atomic Composition ProtParam

Amino Acid & Atomic Composition

Amino Acid & Atomic Composition Amino Acid Composition Atomic Composition

Computing pI and MW

MW pIpI

Protein Sequence Searching P02571

Protein Sequence Searching

Sequence Alignment Input Query Amino Acid Sequence DNA Sequence Blastptblastn blastn blastxtblastx Compares Against protein Sequence Database Compares Against Translated Nucleotide Sequence Database Compares Against Nucleotide Sequence Database Compares Against protein Sequence Database Compares Against Translated Nucleotide Sequence Database

Sequence Alignment

Sequence Alignment

Similarity is very low No similarity

The Information Stored in Genes Is Expressed by a Multistage Process

The Genetic Code Is Degenerate

DNA Translate to Protein

DNA Translate to Protein DNA Protein

DNA Translate to Protein

DNA sequence

DNA Translate to Protein

Protein-protein Interactions on the Web Yeast C. Elegans H. Pylori Drosophila

Yeast Protein Linkage Map Data New protein-protein interactions in yeast Stanley Fields Lab List of interactions with links to YPD

Yeast Protein Linkage Map Data

GeneScape PathwayCalling: Protein interaction and pathway Analysis PATHCALLING YEAST DATABASE

GeneScape

GeneScapeMIPS Currently about 9750 protein-protein-interactions (8250 physical and 1500 genetic) are annotated.

Yeast Interacting Proteins Database (YIPD) Yeast Interacting Proteins Database

Genetic Network Visualization System Workbench System for Support of Gene Regulatory Network Construction YIPD

Java Applet YIPD

GUI System Help YIPD

Pathway Software BIOCARTA Browse all pathway

Pathway Software BIOCARTA

Pathway Result 1: Enolase Glycolysis Pyruvate Acetyl-CoA ethanol lactate Cancer cells BIOCARTA

Pathway Result 2 : Retinoic Acid Receptor RXR-alpha BIOCARTA

Useful BioWeb Site nameURLInformation available MOWSE mass mapping and sequencing ProFoundhttp://prowl.rockefeller.edu/cgi- bin/ProFound Peptide mass mapping and sequencing PeptIdenthttp:// mass mapping and sequencing PepSeahttp:// /PepSeaIntro.htmlPeptide mass mapping and sequencing MASCOThttp:// mass mapping and sequencing PepFraghttp:// mass mapping and sequencing Protein Prospectorhttp://prospector.ucsf.edu/Peptide mass mapping and sequencing FindModhttp:// modification SEAQUESThttp://fields.scripps.edu/sequest/Uninterpreted MS/MS searching FASTA Search Programs and nucleotide database searching Cleaved Radioactivity of Phosphopeptides phosphorylation site mapping