Bio 465 Summary. Overview Conserved DNA Conserved DNA Drug Targets, TreeSAAP Drug Targets, TreeSAAP Next Generation Sequencing Next Generation Sequencing.

Slides:

Advertisements

Similar presentations

Martin John Bishop UK HGMP Resource Centre Hinxton Cambridge CB10 1 SB

Advertisements

The Diversity and Integration of Biological Network Motifs Seminars in Bioinformatics Martin Akerman 31/03/08.

Genomics: READING genome sequences ASSEMBLY of the sequence ANNOTATION of the sequence carry out dideoxy sequencing connect seqs. to make whole chromosomes.

Integrating Genomes D. R. Zerbino, B. Paten, D. Haussler Science 336, 179 (2012) Teacher: Professor Chao, Kun-Mao Speaker: Ho, Bin-Shenq June 4, 2012.

Chapter 3 Ying Xu. Total numbers of occurrences of X in coding and noncoding regions. Relative frequency (RF)of X in coding regions = number of.

Profiles for Sequences

Bioinformatics Dr. Aladdin HamwiehKhalid Al-shamaa Abdulqader Jighly Lecture 1 Introduction Aleppo University Faculty of technical engineering.

Bio-bio-1 Team Advisor: Dr. Supten Sarbadhikari Members: Fokhruz Zaman Zohirul Alam Tiemoon Saddam Hossain Farjana Khatun.

JYC: CSM17 BioinformaticsCSM17 Week 10: Summary, Conclusions, The Future.....? Bioinformatics is –the study of living systems –with respect to representation,

Non-coding RNA William Liu CS374: Algorithms in Biology November 23, 2004.

Introduction to BioInformatics GCB/CIS535

The Central Dogma of Molecular Biology (Things are not really this simple) Genetic information is stored in our DNA (~ 3 billion bp) The DNA of a.

Computational Genomics Lecture 1, Tuesday April 1, 2003.

Signaling Pathways and Summary June 30, 2005 Signaling lecture Course summary Tomorrow Next Week Friday, 7/8/05 Morning presentation of writing assignments.

CISC667, F05, Lec27, Liao1 CISC 667 Intro to Bioinformatics (Fall 2005) Review Session.

Protein Structures.

Ayesha Masrur Khan Spring Course Outline Introduction to Bioinformatics Definition of Bioinformatics and Related Fields Earliest Bioinformatics.

Presented by Liu Qi An introduction to Bioinformatics Algorithms Qi Liu

341: Introduction to Bioinformatics Dr. Natasa Przulj Deaprtment of Computing Imperial College London

Doug Brutlag Professor Emeritus Biochemistry & Medicine (by courtesy) Genome Databases Computational Molecular Biology Biochem 218 – BioMedical Informatics.

Cédric Notredame (30/08/2015) Chemoinformatics And Bioinformatics Cédric Notredame Molecular Biology Bioinformatics Chemoinformatics Chemistry.

9/30/2004TCSS588A Isabelle Bichindaritz1 Introduction to Bioinformatics.

5.1 Proteomics tools on ExPASy. 5.2 (Part 1) Primary, secondary, and tertiary protein structure.

1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.

Databases in Bioinformatics and Systems Biology Carsten O. Daub Omics Science Center RIKEN, Japan May 2008.

Chapter 13. The Impact of Genomics on Antimicrobial Drug Discovery and Toxicology CBBL - Young-sik Sohn-

Secondary Databases Ansuman sahoo Roll: Y Bioinformatics Class Presentation 30 Jan 2013.

Igor Ulitsky.  “the branch of genetics that studies organisms in terms of their genomes (their full DNA sequences)”  Computational genomics in TAU ◦

Master’s Degrees in Bioinformatics in Switzerland: Past, present and near future Patricia M. Palagi Swiss Institute of Bioinformatics.

Intelligent systems in bioinformatics Introduction to the course.

10/17/05 D Dobbs ISU - BCB 444/544X: Genes & Genomes1 10/17/05 Genes & Genomes (formerly Gene Prediction - 1)

Integrating the Bioinformatic Technology Group into your research programme Introduction People and Skills Examples Integrating the BTG Contacts BHRC Away.

Next Generation Sequencing pipeline: a joint LONI – BIRN [UCLA – UCI] collaborative project F. Macciardi – March 16, 2011.

Predicting protein degradation rates Karen Page. The central dogma DNA RNA protein Transcription Translation The expression of genetic information stored.

Cellular Profiles Exploring gene expression profile patterns Pathways, Profiles and Predictions Brad Windle Associate Professor of Medicinal Chemistry.

Comp. Genomics Recitation 9 11/3/06 Gene finding using HMMs & Conservation.

Eukaryotic Gene Prediction Rui Alves. How are eukaryotic genes different? DNA RNA Pol mRNA Ryb Protein.

Decoding the Network Footprint of Diseases With increasing availability of data, there is significant activity directed towards correlating genomic, proteomic,

Central dogma: the story of life RNA DNA Protein.

EB3233 Bioinformatics Introduction to Bioinformatics.

Bioinformatics lectures at Rice University Li Zhang Lecture 11: Networks and integrative genomic analysis-3 Genomic data

Recombination breakpoints Family Inheritance Me vs. my brother My dad (my Y)Mom’s dad (uncle’s Y) Human ancestry Disease risk Genomics: Regions  mechanisms.

.1Sources of DNA and Sequencing Methods.1Sources of DNA and Sequencing Methods 2 Genome Assembly Strategy and Characterization 2 Genome Assembly.

Prediction of Protein Binding Sites in Protein Structures Using Hidden Markov Support Vector Machine.

Short read alignment BNFO 601. Short read alignment Input: –Reads: short DNA sequences (upto a few hundred base pairs (bp)) produced by a sequencing machine.

1 Rong-I Hong, D.Phil. An Overview for Bioinformatics Rong-I Hong, D.Phil. Biomedical Engineering Center Industrial Technology Research Institute

The Future of Genetics Research Lesson 7. Human Genome Project 13 year project to sequence human genome and other species (fruit fly, mice yeast, nematodes,

Hidden Markov Model and Its Application in Bioinformatics Liqing Department of Computer Science.

Bioinformatics Dipl. Ing. (FH) Patrick Grossmann

Genome Annotation Assessment in Drosophila melanogaster by Reese, M. G., et al. Summary by: Joe Reardon Swathi Appachi Max Masnick Summary of.

Week 8. Homework 7 2 state HMM – State 1: neutral – State 2: conserved Emissions: alignment columns – Alignment of human, dog, mouse sequences AATAAT.

Bioinformatics Research Overview Li Liao Develop new algorithms and (statistical) learning methods > Capable of incorporating domain knowledge > Effective,

454 Genome Sequence Assembly and Analysis HC70AL S Brandon Le & Min Chen.

Introduction to Bioinformatics Summary Thomas Nordahl Petersen.

Notes: Human Genome (Right side page)

CISC667, S07, Lec25, Liao1 CISC 467/667 Intro to Bioinformatics (Spring 2007) Review Session.

BNFO 615 Fall 2016 Usman Roshan NJIT. Outline Machine learning for bioinformatics – Basic machine learning algorithms – Applications to bioinformatics.

Bioinformatics Overview

EGASP 2005 Evaluation Protocol

Statistical Applications in Biology and Genetics

EGASP 2005 Evaluation Protocol

High-throughput Biological Data The data deluge

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

A User’s Guide to GO: Structural and Functional Annotation

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Protein Structures.

Different Genes ~ Protein Primary Structure

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Presentation transcript:

Bio 465 Summary

Overview Conserved DNA Conserved DNA Drug Targets, TreeSAAP Drug Targets, TreeSAAP Next Generation Sequencing Next Generation Sequencing Assembly Assembly Gene Finding Gene Finding Hidden Markov Models Hidden Markov Models Secondary Structure Secondary Structure Neural Networks Neural Networks Tertiary Structure Tertiary Structure Pymol, Structural Alignment Pymol, Structural Alignment Systems Biology Systems Biology

TreeSAAP

Conservation

Next Generation Sequencing Assembly for de-novo projects Assembly for de-novo projects Expression for human genome Expression for human genome

Gene finding

Secondary Structure Prediction

Neural Networks

Tertiary Structure Alignment

Systems Biology

Pathway Analysis

SNPs

Goal Improve the human condition Improve the human condition