OEB 192 – 08.10.08. How follow diversification? MLST for Streptococcus pneumoniae (Fraser et al., 2007) (Feil, 2003)

Slides:



Advertisements
Similar presentations
Ortholog vs. paralog? 1. Collect Sequence Data Good Dataset
Advertisements

Arranged by: 1.Nur Laely Mubarokah 2.Lita Purnamasari 3.Andhis Exsa Seftilian 4.Anindita safitri 5.Rizqi Nur Amalia.
“Everything is everywhere – the environment selects.” (Baas-Becking, 1934) “Although there is no direct effect of distance per se, distance is related.
1) What evolutionary force creates adaptations A) mutation B) genetic drift C) selection D) migration.
Detecting HGT: unlikely presence/absence HGT onlyLoss only (Koonin, 2003) Ex: glycerol-3-P DH OEB 192 –
OEB 192 – Tradeoffs, specialization & pleiotropy.
OEB 192 – Evolution of pathogens (Grenfell et al., 2004)
BIOS E-127 – Microbial species, biogeography & population genetics.
OEB 192 – Mobile genetic elements and adaptive mutation.
OEB 192 – Mutation rate & population size II.
OEB 192 – Phenotypic diversity & epigenetics.
OEB 192 – Evolution of cooperation. Important reducer of greenhouse gas emissions (90% of marine methane from marine sediments oxidized by.
OEB 192 – Evolution of pathogens (Grenfell et al., Science)
What can sequences tell us? BIOL E-127– 10/15/07.
OEB 192 – “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical.
OEB 192 – Phenotypic diversity & epigenetics.
How follow diversification? MLST for Streptococcus pneumoniae (Fraser et al., 2007) (Feil, 2003) OEB 192 –
OEB 192 – Phenotypic diversity & epigenetics.
ACTIVITY 2: SIZE AND SCALE MATTER! Original drawings by John Tenniel.
More on neutral theory OEB 192 – Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.
Detecting HGT: discordant phylogenies OEB 192 –
OEB 192 – Phenotypic diversity & epigenetics.
OEB 192 – Mutation rate & population size I.
OEB 192 – “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical.
First Phylogenetics Assignment: Due Oct 27 th (not Oct. 20 th )
Dissemination Strategies November 19, 2010 SPECIAL DIABETES PROGRAM FOR INDIANS Healthy Heart Project Initiative: Year 1 Meeting 1.
Genetic exchange in bacteria/archaea OEB 192 –
OEB 192 – Epistasis. (Segrè et al., Nat. Genet.)
Genetic exchange in bacteria/archaea OEB 192 – (Worobey et al., 2010, last Friday)
BIOS E-127 – Diversification & co-evolution.
BIOS E-127 – Phenetics vs. cladistics Lysozyme amino acid changes in unrelated ruminants Phenetics vs. cladistics.
Species “Species are groups of actually or potentially interbreeding populations, which are reproductively isolated from other such groups” (Mayr, 1942)
The phylogenetics project data revealed! October 4, 2010 OEB 192.
OEB 192 – Dynamics of adaptation. (Miki Lee, Nigel Delaney, Maryska Kaczmarek, Lewis Ward) In humidified, 30 °C room: 48-well plates Plate-shaking.
Species “Species are groups of actually or potentially interbreeding populations, which are reproductively isolated from other such groups” (Mayr, 1942)
Biogeography Chapter 1.
BIO 411 – Medical Microbiology Chapter 9 Commensal and Pathogenic Microbial Flora.
Sebastian Suerbaum & Christine Josenhans
Miracles can be achieved by mixture modelling of messy data.. Chromopainter/FineSTRUCTURE/Globetrotter.
Biodiversity hotspots of primary producers at the global scale Alice Soccodato In collaboration with: d’Ovidio F, De Monte S, Levy M, Follows M, Alvain.
 Smart Skills Week 11 Map 3. Monday What do the different colors represent on this map? World Population Distribution People Per Sq. Mile Per Nation.
“It is less clear, however, whether our species demarcations provide this information for the vast majority of prokaryotes that are never going to cause.
What is ExtremeBiology?. Is this extreme biology?
HAPPY TUESDAY Bellwork: On your bellwork sheet write “Mosst Missed Quiz and Fill in KWL Chart”. On the “Natural Selection Video Guide” Handout, fill in.
HAPPY WEDNESDAY E3 Computer Bellwork: 1.15 minutes for the quiz. 2.Imagine that you are traveling in Madagascar when you find the plant to the right. You.
HAPPY MONDAY D3 Computer Bellwork: 1. Get a laptop for your table (you and your shoulder partner), go ahead and log in. 2. Have out your Notecard Sticker.
LESSON 8: PowerPoint slides to accompany Using Bioinformatics: Genetic Testing.
What is a phylogenetic tree? Agenda for Tuesday Nov 30 th 1.Mechanisms of Evolution notes.
Comparative methods wrap-up and “key innovations”.
Warm-up 2/21: Measure the length of your hand in cm. Place ruler up on desk & Stand your hand up. Measure from bottom of palm to tip of tallest finger.
Bioinformatics for Clinical Microbiology and Molecular Epidemiology: From Databases to Population Genetics João André Carriço 7 July 2010 Ciência 2010.
Darwin’s only figure in “The Origin of Species” (1859)
Unicellular organisms have large populations.
(Adapted and reprinted with permission, from Hughes JM et al: Effect of lung volume on the distribution of pulmonary blood flow in man. Respir Physiol.
Darwin’s only figure in “The Origin of Species” (1859)
أنماط الإدارة المدرسية وتفويض السلطة الدكتور أشرف الصايغ
Genome Evolution: Horizontal Movements in the Fungi
Demonstration of Helicobacter pylori by the four staining methods: (A) modified Giemsa, (B) anti-H pylori antibody immunostain, (C) modified McMullen's.
Genome Evolution: Horizontal Movements in the Fungi
Advances in Understanding Bacterial Pathogenesis Gained from Whole-Genome Sequencing and Phylogenetics  Elizabeth Klemm, Gordon Dougan  Cell Host & Microbe 
Chapter 10-3 Notes: Natural Selection in Action
This or That?.
Label frequency and average enrichment of taxa.
PKS distribution. PKS distribution. (A) Network map for known (purple) and unknown (yellow) PKS clusters, with the cluster number at each node and the.
Distribution of ARGs in RefSoil genomes and plasmids.
Spatial distribution of individual genotypes in a subpart (of size 500 grid units × 700 grid units) of the total grid after the last cycle in one replicate.
Gut Microbiome Studies
Pneumococcus Adapts to the Sickle Cell Host
Phylogenetic trees of S. oralis and S. mitis strains.
Relative abundances of bacterial/archaeal groups in 16S rRNA data set.
Presentation transcript:

OEB 192 –

How follow diversification? MLST for Streptococcus pneumoniae (Fraser et al., 2007) (Feil, 2003)

Population genetic structure from MLST modest HGT high HGT (Feil, 2004)

MLSA in taxonomy: Burkholderia (Fraser et al., 2007)

Single rule may not always apply (Nesbø et al., 2006)

“Everything is everywhere – the environment selects.” (Baas-Becking, 1934) Microbial biogeography

Non-random distributions of free-living taxa (Hughes Martiny et al., 2006)

Biogeography: Sulfolobus (Whitaker et al., 2003)

Microbes in a host w/ biogeography: Helicobacter pylori (Falush et al.,2003)

Speciation through time

Wednesday (10/15): *No class Monday **Turn in phylogenetics project Dynamics of adaptation