More on neutral theory OEB 192 – 10.09.15. Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.

Slides:

Advertisements

Similar presentations

CS 598AGB What simulations can tell us. Questions that simulations cannot answer Simulations are on finite data. Some questions (e.g., whether a method.

Advertisements

A Separate Analysis Approach to the Reconstruction of Phylogenetic Networks Luay Nakhleh Department of Computer Sciences UT Austin.

Ortholog vs. paralog? 1. Collect Sequence Data Good Dataset

Correlating traits with phylogenies Using BaTS. Phylogeny and trait values A phylogeny describes a hypothesis about the evolutionary relationship between.

An Introduction to Phylogenetic Methods

An Introduction to Phylogenetics > Sequence 1 GAGGTAGTAATTAGATCCGAAA… > Sequence 2 GAGGTAGTAATTAGATCTGAAA… > Sequence 3 GAGGTAGTAATTAGATCTGTCA… Anton E.

1 General Phylogenetics Points that will be covered in this presentation Tree TerminologyTree Terminology General Points About Phylogenetic TreesGeneral.

Molecular Evolution Revised 29/12/06

BIOE 109 Summer 2009 Lecture 4- Part II Phylogenetic Inference.

“Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

An example story OEB (Nature 394:69-72)

What can sequences tell us? BIOL E-127– 10/15/07.

OEB 192 – “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical.

An example story OEB (Nature 394:69-72)

Dispersal models Continuous populations Isolation-by-distance Discrete populations Stepping-stone Island model.

OEB 192 – Mutation rate & population size I.

Genetic exchange in bacteria/archaea OEB 192 –

“Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Genetic exchange in bacteria/archaea OEB 192 – (Worobey et al., 2010, last Friday)

BIOS E-127 – Phenetics vs. cladistics Lysozyme amino acid changes in unrelated ruminants Phenetics vs. cladistics.

Probabilistic methods for phylogenetic trees (Part 2)

Lecture 13 – Performance of Methods Folks often use the term “reliability” without a very clear definition of what it is. Methods of assessing performance.

Chapter 2 Opener How do we classify organisms?. Figure 2.1 Tracing the path of evolution to Homo sapiens from the universal ancestor of all life.

Building Phylogenies Distance-Based Methods. Methods Distance-based Parsimony Maximum likelihood.

Phylogenetic Analysis. 2 Phylogenetic Analysis Overview Insight into evolutionary relationships Inferring or estimating these evolutionary relationships.

Bioinformatics tools for phylogeny and visualization

Phylogenetic analyses Kirsi Kostamo. The aim: To construct a visual representation (a tree) to describe the assumed evolution occurring between and among.

Terminology of phylogenetic trees

Molecular phylogenetics

Chapter 26: Phylogeny and the Tree of Life Objectives 1.Identify how phylogenies show evolutionary relationships. 2.Phylogenies are inferred based homologies.

COMPUTATIONAL MODELS FOR PHYLOGENETIC ANALYSIS K. R. PARDASANI DEPTT OF APPLIED MATHEMATICS MAULANA AZAD NATIONAL INSTITUTE OF TECHNOLOGY (MANIT) BHOPAL.

Phylogenetic Analysis. General comments on phylogenetics Phylogenetics is the branch of biology that deals with evolutionary relatedness Uses some measure.

Phylogenetic trees School B&I TCD Bioinformatics May 2010.

Phylogenetics and Coalescence Lab 9 October 24, 2012.

Bioinformatics 2011 Molecular Evolution Revised 29/12/06.

Phylogeny GENE why is coalescent theory important for understanding phylogenetics (species trees)? coalescent theory lets us test our assumptions.

Introduction to Phylogenetic Trees

Announcements Urban Forestry project starts this week. Go through protocol. We'll be sending you off on your own. Please act responsibly. Peer review of.

Introduction to Phylogenetics

Calculating branch lengths from distances. ABC A B C----- a b c.

Molecular Phylogeny. 2 Phylogeny is the inference of evolutionary relationships. Traditionally, phylogeny relied on the comparison of morphological features.

Parsimony is Computationally Intensive

Phylogeny Ch. 7 & 8.

Algorithmic research in phylogeny reconstruction Tandy Warnow The University of Texas at Austin.

Ayesha M.Khan Spring Phylogenetic Basics 2 One central field in biology is to infer the relation between species. Do they possess a common ancestor?

The Big Issues in Phylogenetic Reconstruction Randy Linder Integrative Biology, University of Texas

CS 395T: Computational phylogenetics January 18, 2006 Tandy Warnow.

Building Phylogenies Maximum Likelihood. Methods Distance-based Parsimony Maximum likelihood.

Phylogenetic trees. 2 Phylogeny is the inference of evolutionary relationships. Traditionally, phylogeny relied on the comparison of morphological features.

Darwin’s Tree of Life, July million species Phylogenetic inference from genomic.

Phylogeny and the Tree of Life

Introduction to Bioinformatics Resources for DNA Barcoding

Evolutionary genomics can now be applied beyond ‘model’ organisms

Phylogenetic basis of systematics

Gene-sequence analysis reveals at least three species hidden in Zausodes arenicolus Erin Easton November 13, 2008.

Phylogenetic Inference

Methods of molecular phylogeny

BNFO 602 Phylogenetics Usman Roshan.

Parsimony is Computationally Intensive

Bootstrapping in MEGA:

Q-Q plot of observed P values against theoretical P values for factor analysis (red dots) and single gene–based methods (in blue). Q-Q plot of observed.

Chapter 19 Molecular Phylogenetics

Volume 9, Issue 9, Pages (September 2016)

Whole genome-based phylogenetic analysis of Rickettsiae

(A) Tiled view of an ESOM map constructed using all 51 metagenome bins assembled from the samples collected in this study, with the white square encompassing.

Algorithms for Inferring the Tree of Life

But what if there is a large amount of homoplasy in the data?

Comparison of 16S sequencing and shallow shotgun recovery of species-level taxa. Comparison of 16S sequencing and shallow shotgun recovery of species-level.

16S rRNA-based phylogeny of sponge-associated cyanobacteria and chloroplasts. 16S rRNA-based phylogeny of sponge-associated cyanobacteria and chloroplasts.

Presentation transcript:

More on neutral theory OEB 192 –

Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA Species C TTCACTAGACCTGTGGTCCA Species D TTGACCAGACCTGTGGTCCG Species E TTGACCAGTTCTCTAGTTCG A B C D E Choose methods: distance-based A B C D E Species A Species B Species C Species D Species E ---- A B C D E Species A Species B Species C Species D Species E M(AB)=d(AB) -[(r(A) + r(B))/(N-2)]

4. Choose Methods Maximum Parsimony (MP): Model: Evolution goes through the least number of changes Maximum Likelihood (ML): L (data| model) Bayesian Inference Discrete character methods

3. Choose Models Ancestral Sequences Observed Sequences ? Model Choose “model”

5. Assess Reliability I. Bootstrap Re-sampling to produce pseudo-dataset (random weighting) II. Jacknife Sampling with replacement III. Permutation test Random deletion of sub-dataset Randomize dataset to build null likelihood distribution CGATCGTTA CAATGATAG CGCTGATAA CGCTGATCG taxa1 taxa2 taxa3 taxa Dataset1: Dataset2: … Dataset1: Dataset2: … Assess reliability

5. Assess Reliability Utility of phylogeny: Molecular clock (Korber et al., 2000)

5. Assess Reliability Utility of phylogeny: Molecular clock (Korber et al., 2000)

5. Assess Reliability Utility of phylogeny: Molecular clock (Hillis, 2000)

Utility of phylogeny: infer past environment? (Gaucher et al., 2003)

Molecular signs of selection (Sawyer & Malik, 2006)

Genetic exchange in bacteria/archaea

Monday (9/20): Horizontal gene transfer

Upcoming talks in microbial evolution… MSI Chalktalk Breakfast Friday, Sept 17 th 8:45-9:30 am “Time series analyses of the flora during enteric infections” Lynn Bry HMS Host: Colleen Cavanaugh Please join us for coffee/tea/pastries at 8:30 am - Directions to 24 Oxford St: - Join MSI-news listserv: and in the body of your , copy the text: subscribe