Sequencing Tomato Chr9 Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007 Antonio Granell IBMCP, Valencia.

Slides:



Advertisements
Similar presentations
Sequencing the Maize Genome Maize Genome Sequencing Consortium
Advertisements

Chr9 A ntonio Granell IBMCP-Valencia Spain Tomato Sequencing, Madison July 2006.
The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.
Progress on the sequencing of the euchromatic gene rich space of chromosome 6 of Solanum lycopersicum cv. Heinz 1706 Sander Peters Cologne Oct 2008.
The International Tomato Sequencing Project: The first Cornerstone of the SOL Project Lukas Mueller on behalf of International SOL Tomato Sequencing Project.
US Tomato sequencing project update January 14, 2007.
Progress on the sequencing of the euchromatic gene rich space of chromosome 6 of Solanum lycopersicum cv. Heinz 1706 Sander Peters Sep 2007.
PAA / Solanaceae July 23-27, Madison, Wisconsin, USA Sequencing the gene-rich space of tomato chromosome 7 Current status of the French effort.
Sequencing Status of the Chromosome 8 and New Marker Development toward a Genetic Map Construction between Micro-Tom and Ailsa Craig SOL Genomics Workshop.
1 Sequencing Workshop Koln, October 15, 2008 Toni Granell My apologies for not being here Thanks Joyce Chr9 sequencing update Spain.
Expanding the Tool Kit for BAC Extension Summary of completion criteria developed for NSF Tomato Sequencing Workshop January 14, 2007.
Tomato Chromosome 2 PAG 2009 Doil Choi, Korea. Summary of chromosome 2 sequencing 142 cM 129cM CNR (?) Markers (cM)
Use of FISH in sequencing tomato chromosome 6 René Klein Lankhorst Hans de Jong Korea meeting 2007.
Tomato Chromosome 8 sequencing at Kazusa DNA Research Institute Erika Asamizu.
EU-SOL 2008 November 13-16, Toulouse, FRANCE CHROMOSOME 7 SEQUENCING Current status and perspective TG216 TG438 T1112 T1355 T1328 T1428 T1962 T1414 T1497.
SOL Genomics Network Formed in 2003 to answer two questions: – How can a common set of genes give rise to such a wide range of morphologically and ecologically.
Plant and Animal Genome Conference January 11, 2009.
Chromosome 8 Sequencing: Current Status and Future Prospects toward Finishing Shusei Sato, Erika Asamizu, Takakazu Kaneko, Hiroyuki Fukuoka, Satoshi Tabata.
What is SGN? S GN is a rapidly evolving comparative resource for the plants of the Solanaceae family, which includes important crop and model plants such.
Solanum lycopersicum Chromosome 4 Sequencing Update SOL Germany– October 2008 Wellcome Trust Medical Photographic Library.
Tomato Chromosome 4: A Mapping & Sequencing Update 28 th September 2005 Christine Nicholson Mapping Core Group Welcome Trust Sanger Institute, UK.
Update tomato chr. 6 Roeland van Ham Centre for BioSystems Genomics The Netherlands.
SOL 2008 October 12-16, Cologne, Germany CHROMOSOME 7 THE FRENCH CONTRIBUTION TG216 TG438 T1112 T1355 T1328 T1428 T1962 T1414 T1497 T0676 TM18 CT54 T0966.
Tomato Genome Sequencing: Indian Contribution on Chromosome 5.
Tomato Overgo Project and Seed BAC Selection Cornell Team Ying Eileen Wang, 2005 PAG.
Progress on sequencing tomato chromosome 12 Mara Ercolano.
Status report on gap closure of the human chromosome 5 BAC map Authentication of C5 BAC maps Map and sequence status Gap status and steps used to close.
Mapping and sequencing chromosome 6 of Solanum lycopersicum cv
Solanum lycopersicum Chromosome 4 Sequencing Update UK-SOL– Dec 2008 Wellcome Trust Medical Photographic Library.
Current Sequencing Status of Tomato Chromosome 2 PLANT GENOME RESEARCH CENTER, KRIBB, KOREA Sanghyeob Lee Sung-Hwan Jo Dal-Hoe Koo Chul-Goo Hur Hong-Seok.
4th Solanaceae Genome Workshop 2007, September 09th- 13th, Jeju Island, Korea THE FRENCH CONTRIBUTION TO THE INTERNATIONAL TOMATO GENOME SEQUENCING PROGRAM.
FINISHING WORKSHOP APRIL 2008 CHROMOSOME 7 THE FRENCH CONTRIBUTION TG216 TG438 T1112 T1355 T1328 T1428 T1962 T1414 T1497 T0676 TM18 CT54 T0966 T0731 TM15.
Finishing tomato chromosomes #6 and #12 using a Next Generation whole genome shotgun approach Roeland van Ham, CBSG, NL René Klein Lankhorst, EUSOL Giovanni.
Chromosome 2 Doil Choi, Sunghwan Jo KOREA. Cytological architecture of chromosome kb/µm DAPI (4’-6-diamidino-2-phenylindole) stained pachytene chromosome.
Progress tomato chromosome 6 René Klein Lankhorst.
INDIAN INITIATIVE FOR TOMATO GENOME SEQUENCING Nagendra Singh National Research Centre on Plant Biotechnology Indian Agricultural Research Institute New.
Chromosome 12 M. Pietrella 1, G. Falcone 1, E. Fantini 1, A. Fiore 1, C. Perla 1, M.R. Ercolano 2, A. Barone 2, M.L. Chiusano 2, S. Grandillo 3, N. D’Agostino.
Chromosome 12 M. Pietrella 1, G. Falcone 1, E. Fantini 1, A. Fiore 1, M.R. Ercolano 2, A. Barone 2, M.L. Chiusano 2, S. Grandillo 3, N. D’Agostino 2, A.
Wageningen, April 24-25, 2008 II Tomato Finishing Workshop Chromosome 12 Update ENEA, Rome University of Naples ‘Federico II’ CRIBI and Univ. of Padua.
HeterochromatinEuchromatin Relative chromosome length Relative bivalent diameter X 1.23 X 1.00 Relative area Relative optical density.
Human Genome.
2nd TOMATO FINISHING WORKSHOP chromosome 9 Wageningen, April 24-25, 2008.
Italy: tomato chr. 12 Country Representative: Dr. Giovanni Giuliano Maria Luisa Chiusano Maria Raffaella Ercolano University.
Progress on sequencing tomato chromosome N22 (Chromosome 12—Telomere P) Stack Lab--April 8,2005 LE_HBa0045N22 LE_HBa0026C13 Estimated euchromatin.
International Tomato Genome Sequencing Project 70 µm 0 µm Mb 85.6 Mb 83.6 Mb 82.1 Mb 80.0 Mb 53.8 Mb 80.3 Mb 64.7 Mb 81.8 Mb 88.5.
Solanum lycopersicum Chromosome 4 Mapping and Finishing Update SRC-UK and Wellcome Trust Sanger Institute SOL Korea – September 2007 Wellcome Trust Medical.
Lindsay A. Shearer1, Lorinda K
70 µm 0 µm International Tomato Genome Sequencing Project Mb 85.6 Mb 83.6 Mb 82.1 Mb 80.0 Mb 53.8 Mb 80.3 Mb 64.7 Mb 81.8 Mb 88.5.
13 th January 2008 Plant & Animal Genome Conference Progress with Sequencing Tomato Chromosome 4 Clare Riddle Tomato Project Group Wellcome Trust Sanger.
16 th April 2007 Christine Nicholson, Mapping Core Group Wellcome Trust Sanger Institute Tomato Chromosome 4 Mapping & Use of FPC Copyright Wellcome Trust.
26 th July 2006 Christine Nicholson, Mapping Core Group Karen McLaren, Finishing Group Leader Wellcome Trust Sanger Institute Sequencing the Gene Space.
US Contribution to the International Tomato Genome Sequencing Effort Current structure of contributions Ongoing activity summary Funding issues.
CURRENT STATUS ON SEQUENCING OF CHROMOSOME 12 Mara Ercolano Ischia, 2005.
CHROMOSOME 12 Giovanni Giuliano PAG, Tomato chr. 12 Principal Investigators Luigi Frusciante (UniNa) Giovanni Giuliano (ENEA) Giorgio Valle (CRIBI)
University of Delhi South Campus Akhilesh K. Tyagi Jitendra P. Khurana Paramjit Khurana Arun Sharma National Research Centre for Plant Biotechnology Nagendra.
Tomato Sequencing Project Meeting at SOL 2008, Oct. 15, 2008
Plant & Animal Genome Conference
Development of genome sequencing infrastructure and progress toward sequencing of chromosomes 1, 10 and 11 Steve Tanksley, Cornell U Steve Stack, Colorado.
Sequencing Chromosome 2
Status of the US contribution to the international
Progress on sequencing tomato chromosome 12
Progress in sequencing chromosome 6
Current Sequencing Effort of Tomato Chromosome 2 - Chromosome assembly - Finishing workshop April KRIBB/SNU, Korea.
International Tomato Genome Sequencing Project
Progress in sequencing chromosome 6
TG216 TG438 T1112 T1355 T1328 T1428 T1962 T1414 T1497 T0676 TM18 CT54 T0966 T0731 TM15 T1347 T1257 T0848 THE FRENCH CONTRIBUTION TO THE INTERNATIONAL.
Sequencing update of tomato chromosome 3 Chinese Academy of Sciences
Tomato FISH Song-Bin Chang Suzanne Royer Lorrie Anderson Steve Stack.
The Role of Fluorescence in situ hybridization (FISH)
The Potato Genome Sequencing Consortium: An Update
Presentation transcript:

Sequencing Tomato Chr9 Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007 Antonio Granell IBMCP, Valencia

 Estimated euchromatin size : 16 Mb  Number of linked markers: 180  Projected BACs for sequencing: 164  Starting point for sequencing chromosome 9:  264 BACs with anchor markers ( Hind III library)  40 anchor markers but 13 near centromere (141 BACs) 27 anchor markers for selecting seed BACs on the euchromatin sequence (123 BACs) Tomato chromosome 9 Anchor Markers cLPT4C24 TG9 Brix925 SSR70 TG18 T0863 T1680 cTOB1K3 T0765 T1177 T1212 T1416 T1412 cLEB8N3 T1407 T0732 TG186 CT74cLET42O2 T1519 C2_At3g24050 TG328 TG591 T0486 T0521 CT220 T1514 Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007

Marker-BAC association  Design primers for PCR amplification of 25 (out of 27) anchor markers from ~ 70 BAC clones (out of 123)  Sequence BAC ends from ~ 40 BAC clones Marker-BAC association was not confirmed for 10 anchor markers - No PCR product - No marker sequence at the BAC ends Marker-BAC association was confirmed for 15 anchor markers 15 seed BACs to verify location on Chr9 Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007

 We sent 8 BACs  Le_Hba 0107D15 sent from another group, close to euchromatin-herochromatin border on Chr9 9 seed BACs located on Chr9 by FISH  FISH by Stephen Stack lab, Colorado FISH Mapping Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007

ILs Mapping S. pennellii ILs  PCR amplification of 15 anchor markers from BACs and ILs  Amplicon sequencing  Sequence alignment IL9-1-3 IL9-1 IL9-1-2 IL9-2 IL9-2-5 IL9-2-6 IL9-3-1 IL9-3-2 IL9-3 Example: Le_HBa0203J14, TG9  15 seed BACs to map: No polymorphism found in two markers 13 seed BACs confirmed as located on Chr9 by sequencing ILs Le_Hba0203J14 GGCCAACACTGGAAAACACAACTAGGTAGATGGCTATTAGACCAT IL3-4 GGCCAACACTGGAAAACACAACTAGGTAGATGGCTATTAGACCAT IL9-1 GGCCAATACTGGAAAACACAACTAGGTAGATGGCTTCTCTACCATCACACTATACTAAAT 180 IL9-1-2 GGCCAATACTGGAAAACACAACTAGGTAGATGGCTTCTCTACCATCACACTATACTAAAT 180 ****** **************************** ********* Le_Hba0203J GTACTTTACTAAATCTGAGTGC 185 IL GTACTTTACTAAATCTGAGTGC 185 IL9-1 CTGAATGCTCTTTCACTAGATGAGGCTTCTCTACCATCACACTATTCTAAATCTGAATGC 240 IL9-1-2 CTGAATGCTCTTTCACTAGATGAGGCTTCTCTACCATCACACTATTCTAAATCTGAATGC 240 *** * ********** *** Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007

Selected Seed BACs  Marker-specific amplification by PCR and sequence verification  Location on Chr9 confirmed by : FISH only: 2 Sequencing Ils only: 6 FISH and sequencing Ils: 7  Verified BEs (if possible)  We selected 15 seed BACs: Arrows show aproximate BAC location based on Tomato-EXPEN 2000 map Big GAP: 36 cM without seed BACs Distance between some BACs: 2 cM Uneven distribution Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007

 BLASTN against BAC end sequence database at Cornell University No candidates found in some cases Too large overlaps in some cases  FPC data from Hind III and Mbo I libraries at Sanger Institute Some of our BACs are not in a FPC contig FPC contigs are too poor to find good candidates in some cases Selection of extension BACs  Selection is based on: Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007

REQUESTED 2 BACs FISH 1 BAC IMPOSSIBLE TO MAP BY ILs LINES Summary NEW SEED BACs NEEDED Number of BACs in progress decreasing IN PROGRESS 12 BACs 15 seed BACs 18 extending BACs COMPLETE 21 BACs No extending BACs in 8 cases More than 20 kb overlap in 4 BACs Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007

Le_HBa0059I05 Le_HBa0176I09 Le_HBa0226J12 SL_MboI0017K18 Le_HBa0038L16 SL_MboI0104L22 SL_Mbo0058A04 SL_MboI0099J09 Le_HBa0033H16 SL_MboI0037I08 Le_HBa0026I24 Le_HBa0116C14 Le_HBa0168F14 Le_HBa0026P14 Le_HBa0300E15 Le_HBa0203J14 Le_HBa0317H H 44 SL_EcoRI0001L13 SL_EcoRI0130H12 SL_EcoRI0019J03 SL_EcoRI0004H20 SL_EcoRI0103M07 SL_EcoRI0004D19 SL_MboI094P20 SL_EcoRI0009I15 Current Status of Sequencing Short arm H 97 Le_HBa0107D15 Le_HBa0099F14 Le_HBa0099P03 Le_HBa0109D11 Le_HBa0278J12 Le_HBa0165P17 Le_HBa0022M02 Le_HBa0226D21 Long arm Origin of the clone: Seed BACs Extension BACs Status: Completed BACs BACs in progress “Death points”: No extension BACs More than 20 kb overlap Extension points: Requested extension BACs Possible extension points Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007

Overall Status To be sequenced 164 In progress 12 Complete 21 % Done 16 Overall Status Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007

Summary  Additional overgo screening to provide anchored BACs for at least 10 markers for chromosome 9 will be performed by Cornell NEW SEED BACs NEEDED Number of BACs in progress decreasing  Additional screening to provide anchored BACs for at least 30 (SGN, others) markers per will be performed by IBMCP by PCR on BAC pools (Tabata’s lab) or filters (Cornell)  Mapping of 200 BACs containing ORF at both BES on Dani´s ILs  FISH BACs by Hans de Jong Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007

Sequencing and annotation of Tom Chr9 Victoria FernándezSistemas Genómicos Ángela Pérez Antonio GranellIBMCP Roderic Guigó IMIM Francisco Camera Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007 EUSOL