Most proteins in the ER are glycosylated Proteins in cytosol are rarely glycosylated original precursor oligosaccharide added to most proteins in the ER.

Slides:



Advertisements
Similar presentations
The endoplasmic reticulum and the Golgi apparatus permit protein construction and transport in a cell. 11/20 How are cells are divided into organelles.
Advertisements

Chapter 13 Intracellular Vesicular Traffic 張學偉 助理教授.
Lesson 3: Translation.
INTRACELLULAR COMPARTMENTS AND TRANSPORT
Intracellular Compartments and Protein Sorting Haixu Tang School of Informatics.
Protein Sorting & Transport Paths of Protein Trafficking Nuclear Protein Transport Mitochondrial & Chloroplast Transport Experimental Systems Overview.
Chapter 12 Intracellular Compartments and Protein Sorting.
Roadmap of protein traffic inside cell.
Unit 7 Endomembranes. SECRETORY PATHWAY: Unit 7 Secretory Pathway Proteins are synthesized on the Rough ER. Move via vesicles to Golgi Move via vesicles.
Last Class: 1. transportation at the plasma membrane A. carrier protein, B. channel protein 2. intracellular compartments A. nucleus, B. Endoplasmic Reticulum.
Vesicular transport Dr. med. habil. Kőhidai László Assoc. Professor Depertment of Genetics, Cell- and Immunoibiology Semmelwesi University Semmelwesi University2008.
Protein Sorting ISAT 351, Spring 2004 College of Integrated Science and Technology James Madison University.
Molecular mechanism of vesicular transport Vesicular pathway--Budding and fusion 1.Budding— how are vesicles formed? How can cargo proteins be selectively.
Review For Final I. Should I take the final? Can’t hurt you Calculate your average and determine what you need to change your grade.
Membrane Transport Chapter 11. Transcellular transport of glucose.
Lecture 11 Vesicular Trafficking: Lysosomes;
Vesicular Traffic II. Endocytic and secretory pathways red = secretory green = endocytic blue = recycling.
Cytoplasmic Membrane Systems II Lecture 12. How Do Proteins Get Imported Into Membrane Enclosed Organelles? Import Requires Input of Energy to Occur!
Vesicular Transport III. N-linked glycosylation because sugar is added to N of asparagine. original precursor oligosaccharide added to most proteins in.
Cytoplasmic Membrane Systems: Structure, Function, and
Lecture 6 - Intracellular compartments and transport I.
Lecture 7 - Intracellular compartments and transport II
Protein trafficking between membranes By Graham Warren & Ira Mellman
Extra credit for Midterm 2
Chapter 25 Protein trafficking Introduction 25.2 Oligosaccharides are added to proteins in the ER and Golgi 25.3 The Golgi stacks are polarized.
Summary 1.Rough ER and smooth ER; 2.Signal hypothesis, translocation into ER; 3.Single-span and multi-span membrane proteins; 4.Glycosylation; 5.Protein.
INTD5000, Lectures C7 & C8 Professor Eileen M. Lafer Tel#: Office: Room 415B THE SECRETORY AND ENDOCYTIC PATHWAYS.
Endocytosis & Exocytosis By : Matt Sargeant. What is Endocytosis and Exocytosis? Endocytosis is a process by which cells absorb molecules (such as proteins)
Cell Membranes Biological Barriers Gate Keepers. Biological Membranes composition –phospholipids & other membrane lipids (~50% by mass) –various proteins.
Last Class: 1. Posttranscription regulation
Copyright © 2005 Pearson Prentice Hall, Inc. Intracellular Compartments and Transport Membrane Enclosed Organelles Protein Sorting Vesicular Transport.
ER and Golgi: Working Together! Mr. Nichols PHHS.
Receptor-Mediated Endocytosis As Presented By Michael Chan.
Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting How are proteins targeted and delivered?
BioFlix ® Membrane Transport Slide Show Copyright © 2008 Pearson Education, Inc.
STEP 1 Proteins and lipids that are made on the ER membranes are transported through the ER and are packaged in transport vesicles that bud off.
Pg. 367.
1 GCCTCAATGGATCCACCACCCTTTTTGGGCA GCCTCAATGGATCCACCACCCTTTTTGGTGCA AGCCTCAATGGATCCACCACCCTTTTTGGTGC AAGCCTCAATGGATCCACCACCCTTTTTGGTG CAAGCCTCAATGGATCCACCACCCTTTTTGGT.
Copyright (c) by W. H. Freeman and Company 17.3 The rough ER is an extensive interconnected series of flattened sacs Figure
Vesicular Transport Pages The general flow of membrane enclosed material within cells.
Vesicular Trafficking Movement From the ER Through the Golgi.
Membrane Transport How stuff gets in or out. Membrane Transport Objectives:  Relate membrane structures to transport processes.
MB207 Molecular Cell Biology Intracellular Vesicular Traffic Outline: Principles of vesicular traffic Transport from ER through Golgi Apparatus Transport.
Lecture 12: The secretory pathway
The ER and Golgi Modify & Sort Proteins
1 Chapter 1 Plant Cells Overview  Earth’s primary producers  Nonmotile  Structure to catch light and sense gravity  Structure for transporting water.
Endomembrane system and vesicular transport
Active Transport Processes
The building blocks of life
Protein Sorting & Transport
Vesicular transport Dr. med. habil. Kőhidai László Assoc. Professor
Intracellular Trafficking
Intracellular Compartments and Transport 2
INTD5000, REVIEW, Lectures C7-C8
Intracellular Transport Pathways
The Mechanisms of Vesicle Budding and Fusion
The Road Taken Cell Volume 100, Issue 1, Pages (January 2000)
Signaling at the Surface
A Closer Look at Cell Membranes
Mechanisms and Function of Dendritic Exocytosis
Active Transport Chapter 3, Section 3.
Molecular Mechanisms in Synaptic Vesicle Endocytosis and Recycling
Volume 94, Issue 1, Pages (July 1998)
Translation B Sc III Mr. Maruti Hake Dept.of Botany
3 Cells: The Living Units: Part B.
Coats, Tethers, Rabs, and SNAREs Work Together to Mediate the Intracellular Destination of a Transport Vesicle  Huaqing Cai, Karin Reinisch, Susan Ferro-Novick 
Endocytic and biosynthetic-secretory pathways
Chapter 13 Intracellular Vesicular Traffic.
Intracellular Compartments and Vesicular Trafficking
The Cell in its Environment
Presentation transcript:

Most proteins in the ER are glycosylated Proteins in cytosol are rarely glycosylated original precursor oligosaccharide added to most proteins in the ER

Protein glycosylation in the rough ER

Oligosaccharides are used as tags to mark the state of protein folding

Misfolded proteins are exported from ER and destroyed

Chapter 13 Intracellular Vesicular Traffic

Roadmap of protein traffic inside cell

Endocytic and secretory pathways red = secretory green = endocytic blue = recycling

5.14 Figure 5.14 figure jpg

Vesicular transport

There are various types of coated vesicles

Different coats are used for different transport steps in the cell

Coated Pits are the sites of receptor mediated endocytosis Clathrin protein cytosol Material to be taken up by cell

Clathrin-coated pits and vesicles

Structure clathrin triskelion

Arrangement of triskelion on surface of clathrin coated vesicle

DVD Clip 57

Assembly and disassembly of clathrin coat

Dynamin pinches clathrin coated vesicles from the membrane

Electron micrograph from Drosophila mutant

Resting Chemical Synapse

Drosophila mutant can not recycle synaptic vesicles

SNARE proteins guide vesicular transport

Active Chemical Synapse

Interaction of SNARE proteins while docking synaptic vesicle at nerve terminal

Model for membrane fusion. Tight SNARE pairing forces water molecules from area between lipid bilayers

Exam I average 81.2% median 84% Scramblase question was not graded Add 1 point to your score