Comparative Genomics Bio Informatics Scott Gulledge.

Slides:

Advertisements

Similar presentations

An Introduction to “Bioinformatics to Predict Bacterial Phenotypes” Jerry H. Kavouras, Ph.D. Lewis University Romeoville, IL.

Advertisements

A Lite Introduction to (Bioinformatics and) Comparative Genomics Chris Mueller August 10, 2004.

Phylogenetic Trees Understand the history and diversity of life. Systematics. –Study of biological diversity in evolutionary context. –Phylogeny is evolutionary.

Summer Bioinformatics Workshop 2008 Comparative Genomics and Phylogenetics Chi-Cheng Lin, Ph.D., Professor Department of Computer Science Winona State.

Stochastic approximate inference Kay H. Brodersen Computational Neuroeconomics Group Department of Economics University of Zurich Machine Learning and.

UCSC BIOINFORMATICS Richard Hughey Vice-Chair, Biomolecular Engineering.

Current Approaches to Whole Genome Phylogenetic Analysis Hongli Li.

Bioinformatics Stephen Voglewede. What is Bioinformatics Computers have changed a lot of fields – including biology.

. Class 1: Introduction. The Tree of Life Source: Alberts et al.

Genetica per Scienze Naturali a.a prof S. Presciuttini Human and chimpanzee genomes The human and chimpanzee genomes—with their 5-million-year history.

Bioinformatics and Phylogenetic Analysis

Richard, Rochelle, Zohal, Angie

The BIG Goal “The greatest challenge, however, is analytical. … Deeper biological insight is likely to emerge from examining datasets with scores of samples.”

Novel computational methods for large scale genome comparison PhD Director: Dr. Xavier Messeguer Departament de Llenguatges i Sistemes Informàtics Universitat.

Phylogeny Estimation: Traditional and Bayesian Approaches Molecular Evolution, 2003

1 Business Administrators of today and tomorrow need, along with their business knowledge, analytic insight and understanding, as well the ability.

Bioinformatics Timothy Ketcham Union College Gradutate Seminar 2003 Bioinformatics.

1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.

Using Bayesian Networks to Analyze Expression Data N. Friedman, M. Linial, I. Nachman, D. Hebrew University.

Introduction to MCMC and BUGS. Computational problems More parameters -> even more parameter combinations Exact computation and grid approximation become.

IPlant Collaborative Tools and Services Workshop iPlant Collaborative Tools and Services Workshop Building and Using Workflows Within the DE; Phylogenetics.

Introduction to Bioinformatics Prologue. Bioinformatics Living things have the ability to store, utilize, and pass on information Bioinformatics strives.

Genomics Lecture 8 By Ms. Shumaila Azam. 2 Genome Evolution “Genomes are more than instruction books for building and maintaining an organism; they also.

Genomes and Their Evolution. GenomicsThe study of whole sets of genes and their interactions. Bioinformatics The use of computer modeling and computational.

Computer programming.

Bayes estimators for phylogenetic reconstruction Ruriko Yoshida.

IPlant Collaborative Tools and Services Workshop iPlant Collaborative Tools and Services Workshop Building and Using Workflows Within the DE; Phylogenetics.

Construction of Substitution Matrices

ARE THESE ALL BEARS? WHICH ONES ARE MORE CLOSELY RELATED?

IPlant Collaborative Tools and Services Workshop iPlant Collaborative Tools and Services Workshop Building and Using Workflows Within the DE; Phylogenetics.

Chapter 24: Molecular and Genomic Evolution CHAPTER 24 Molecular and Genomic Evolution.

W w w. u o t t a w a. c a Mathematics and Statistics Faculty of Science Probability and Statistics Group Dept: (613) Fax: (613)

Introduction to Bioinformatics Dr. Rybarczyk, PhD University of North Carolina-Chapel Hill

WMU CS 6260 Parallel Computations II Spring 2013 Presentation #1 about Semester Project Feb/18/2013 Professor: Dr. de Doncker Name: Sandino Vargas Xuanyu.

Comparative Genomics.

IPlant Genomics in Education

Information Technology in the Natural Sciences Biology – Chemistry – Physics.

Why phylogenetics? Barbara Holland School of Physical Sciences University of Tasmania.

Chapter 21 Genomes and Their Evolution. Genomics ______________ is a new approach to biology concerned with the study of the ___________ set of __________.

1 1 Slide © 2004 Thomson/South-Western Simulation n Simulation is one of the most frequently employed management science techniques. n It is typically.

I.U. School of Informatics Motif Discovery from Large Number of Sequences: A Case Study with Disease Resistance Genes in Arabidopsis thaliana by Irfan.

Bioinformatics Dipl. Ing. (FH) Patrick Grossmann

Biotechnology and Bioinformatics: Bioinformatics Essential Idea: Bioinformatics is the use of computers to analyze sequence data in biological research.

HW7: Evolutionarily conserved segments ENCODE region 009 (beta-globin locus) Multiple alignment of human, dog, and mouse 2 states: neutral (fast-evolving),

IPlant Collaborative Tools and Services Workshop iPlant Collaborative Tools and Services Workshop Building and Using Workflows Within the DE; Phylogenetics.

 Phylogenetic trees and Cladograms are hypotheses. The only guarantee is that they will change as we gather and analyze more data. From Young and Strode.

Presenter: Bradley Green.  What is Bioinformatics?  Brief History of Bioinformatics  Development  Computer Science and Bioinformatics  Current Applications.

BLAST: Basic Local Alignment Search Tool Robert (R.J.) Sperazza BLAST is a software used to analyze genetic information It can identify existing genes.

(Quantitative, Evolution, & Development)

Research Paper on BioInformatics

MCMC Output & Metropolis-Hastings Algorithm Part I

Biological Databases By: Komal Arora.

Harnessing the Power of Condor for Human Genetics

Bioinformatics Madina Bazarova. What is Bioinformatics? Bioinformatics is marriage between biology and computer. It is the use of computers for the acquisition,

Pipelines for Computational Analysis (Bioinformatics)

High-throughput Biological Data The data deluge

Bayesian inference Presented by Amir Hadadi

Genomes and their evolution

Genome sequencing informatics

Overview Bioinformatics: Analyzing biological data using statistics, math modeling, and computer science BLAST = Basic Local Alignment Search Tool Input.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

The Human Genome Project and beyond

LESSON 1 INTNRODUCTION HYE-JOO KWON, Ph.D /

Introduction to Bioinformatic

Network Inference Chris Holmes Oxford Centre for Gene Function, &,

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

GENOMICS Copyright © 2009 Pearson Education, Inc..

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Presentation transcript:

Comparative Genomics Bio Informatics Scott Gulledge

Comparative genomics is the study of relationships between the genomes of different species or strains. Comparative genomics is an attempt to take advantage of the information provided by the signatures of selection to understand the function and evolutionary processes that act on genomes. While it is still a young field, it holds great promise to yield insights into many aspects of the evolution of modern species. Comparative genomics is the study of relationships between the genomes of different species or strains. Comparative genomics is an attempt to take advantage of the information provided by the signatures of selection to understand the function and evolutionary processes that act on genomes. While it is still a young field, it holds great promise to yield insights into many aspects of the evolution of modern species.

Why study Comparative Genomics. =

Why study Comparative Genomics? researchers can better understand the structure and function of human genes researchers can better understand the structure and function of human genes develop new strategies in the battle against human disease develop new strategies in the battle against human disease provides a powerful new tool for studying evolutionary changes among organisms provides a powerful new tool for studying evolutionary changes among organisms helping to identify the genes that are conserved among species along with the genes that give each organism its own unique characteristics helping to identify the genes that are conserved among species along with the genes that give each organism its own unique characteristics

How can Computer Science help with Comparative Genomics? Store large amounts of data. Store large amounts of data. Able to compare and analyze chromosomes together quickly and precisely. Able to compare and analyze chromosomes together quickly and precisely. statistical and mathematical techniques. statistical and mathematical techniques.

Certain algorithms used. Uses statistical algorithms and computations: Uses statistical algorithms and computations: Markov chain Monte Carlo. Markov chain Monte Carlo. Bayesian inference. Bayesian inference. Uses Bayes’ Theorem. Uses Bayes’ Theorem.

Related fields with Comparative Genomics. Sequence Analysis. Sequence Analysis. Genome annotation. Genome annotation. Almost any part of Bio Informatics can benefit from Comparative Genomics. Almost any part of Bio Informatics can benefit from Comparative Genomics.

Software Used for Comparative Genomics. BLAST BLAST Sybil Sybil VISTA? VISTA? No Vista Genome Browser !

Vista Genome Browser We will take show a program that helps with Comparative Genomics. We will take show a program that helps with Comparative Genomics. Vista Genome Browser Vista Genome Browser Vista Genome Browser Vista Genome Browser

No more slides… Yep that’s it…. Yep that’s it…. Seriously. Seriously.