Gene Entire nucleic acid sequence necessary for the synthesis of a functional polypeptide (protein chain) or functional RNA Nucleic Acid Sequence 1. DNA (Deoxyribo Nucleic Acid) 2. RNA (Ribo Nucleic Acid)

DNA as Genetic Material DNA encodes all the information in the cell The composition of the DNA is the same in all cells within an organism   Variation among different cells is achieved by reading the DNA differently DNA contains four bases that encode all the information to make an organism’s life

How is Information Encoded in DNA? DNA Consists of four kinds of bases (A,C,G,T) joined to a sugar phosphate backbone Bases carry the genetic information while the phosphate backbone is structural Two complementary strands of bases (C-G) and (A-T)

DNA is a Polymer of Deoxyribonucleotide Units DEOXYRIBONUCLEOTIDE

Deoxyribonucleic Acid (DNA) Nucleotide : Phosphate group Phosphate group 5-carbon sugar 5-carbon sugar Nitrogenous base Nitrogenous base

DNA Nucleotide O O=P-O OPhosphate Group Group N Nitrogenous base (A, G, C, or T) (A, G, C, or T) CH2 O C1C1 C4C4 C3C3 C2C2 5 Sugar Sugar(deoxyribose)

DNA Double Helix Nitrogenous Base (A,T,G or C) “Rungs of ladder” “Legs of ladder” Phosphate & Sugar Backbone

DNA Double Helix P P P O O O P P P O O O G C TA

DNA is Composed of Four Different Ribonucleotides AdenineGuanine ThymineCytosine Two Purines Two Pyrimidines

Nitrogenous Bases PURINES PURINES 1.Adenine (A) 2.Guanine (G) PYRIMIDINES PYRIMIDINES 3.Thymine (T) 4.Cytosine (C) T or C A or G

BASE-PAIRINGSBASE-PAIRINGS Base # of Purines PyrimidinesPairs H-Bonds Adenine (A) Thymine (T)A = T 2 Guanine (G) Cytosine (C)C G 3 CG 3 H-bonds

BASE-PAIRINGSBASE-PAIRINGS CG H-bonds T A

Base Pairing Occurs Through Hydrogen Bonds A-T G-C

Chargaff’s Rule Adenine must pair with Thymine Adenine must pair with Thymine Guanine must pair with Cytosine Guanine must pair with Cytosine Their amounts in a given DNA molecule will be about the same. Their amounts in a given DNA molecule will be about the same. G C TA

Backbone Sugar Molecules Deoxyribose (DNA)Ribose (RNA) 1´ 2´ 3´ 4´ 5´ 1´ 2´ 3´ 4´ 5´ Ribose= Five Carbon Sugar Molecule Deoxy ribo nucleotide

The DNA Backbone is a Deoxyribose Polymer Deoxyribose sugars are linked by Phosphodiester Bonds 5´ 3´ 5´ 3´ 2´ 1´ 5´-p3´-OH 5´3´

5´ 3´ 5´ 3´5´ 3´ 5´ 3´ 5´ 3´ 2´ 1´

5´ 3´ 5´ 3´ 2´ 1´ Base 5´ 3´ 5´ 3´ 2´ 1´

(dATP) Deoxyadenosine 5´-triphosphate DeoxyRibonucleotide DeoxyRibonucleoside Deoxyadenosine

5´ 3´5´ 3´ T C T A G A

= GC AT

Double-stranded DNA Forms a Double Helix

Central Dogma of Biology

DNA, RNA, and the Flow of Information Translation Transcription Replication

Central Dogma (Modifications) Transcription Translation DNA (1)Reverse transcription Replication RNA (2)Self Replication Protein (3)Self Replication (2)Ribozymes

RNA A polymer composed of nucleotides that contain the sugar ribose and one of the four bases cytosine, adenine, guanine and uracile A polymer composed of nucleotides that contain the sugar ribose and one of the four bases cytosine, adenine, guanine and uracile Polynucleotide containing ribose sugar and uracil instead of thymine Polynucleotide containing ribose sugar and uracil instead of thymine Genetic material of some viruses Genetic material of some viruses Primary agent for transferring information from the genome to the protein synthetic machinery Primary agent for transferring information from the genome to the protein synthetic machinery

RNA NUCLEIC ACID, SINGLE SINGLE STRAND, PO4, RIBOSE RIBOSE SUGAR. BASE BASE PAIRS (N): U= URACIL A=ADENINE A=ADENINE C=CYTOSINE C=CYTOSINE G=GUANINE G=GUANINE

URACIL (U) base with a single-ring structure phosphate group sugar (ribose)

Types of RNA Three types of RNA: Three types of RNA: A.messenger RNA (mRNA) B.transfer RNA (tRNA) C.ribosome RNA (rRNA) Remember: all produced in the nucleus! Remember: all produced in the nucleus!

A. Messenger RNA (mRNA) Carries the information for a specific protein. Carries the information for a specific protein. Made up of 500 to 1000 nucleotides long. Made up of 500 to 1000 nucleotides long. Made up of codons ( sequence of three bases: AUG - methionine ). Made up of codons ( sequence of three bases: AUG - methionine ). Each codon, is specific for an amino acid. Each codon, is specific for an amino acid.

A. Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1

B. Transfer RNA (tRNA) Made up of 75 to 80 nucleotides long. Made up of 75 to 80 nucleotides long. Picks up the appropriate amino acid floating in the cytoplasm ( amino acid activating enzyme ) Picks up the appropriate amino acid floating in the cytoplasm ( amino acid activating enzyme ) Transports amino acids to the mRNA. Transports amino acids to the mRNA. Have anticodons that are complementary to mRNA codons. Have anticodons that are complementary to mRNA codons. Recognizes the appropriate codons on the mRNA and bonds to them with H-bonds. Recognizes the appropriate codons on the mRNA and bonds to them with H-bonds.

codon in mRNA anticodon amino acid OH amino acid attachment site anticodon tRNA MOLECULE amino acid attachment site

The structure of transfer RNA (tRNA)

B. Transfer RNA (tRNA) amino acid attachment site UAC anticodon methionine amino acid

C. Ribosomal RNA (rRNA) Made up of rRNA is 100 to 3000 nucleotides long. Made up of rRNA is 100 to 3000 nucleotides long. Important structural component of a ribosome. Important structural component of a ribosome. Associates with proteins to form ribosomes. Associates with proteins to form ribosomes.

RibosomesRibosomes Large and small subunits. Large and small subunits. Composed of rRNA (40%) and proteins (60%). Composed of rRNA (40%) and proteins (60%). Both units come together and help bind the mRNA and tRNA. Both units come together and help bind the mRNA and tRNA. Two sites for tRNA Two sites for tRNA a. P site (first and last tRNA will attach ) b. A site

Ribosomes Origin Complete ribosome Ribosomal subunit rRNA components Proteins Cytosol (eukaryotic ribosome) 80 S 40 S 60 S 18 S 5 S 5 S 5.8 S 25 S C.30C.50 Chloroplasts (prokaryotic ribosome) 70 S 30 S 50 S 16 S 4.5 S 5 S 5 S 23 S C. 24 C. 35 Mtochondrion (prokaryotic ribosome) 78 S  30 S  50 S 18 S 5 S 5 S 26 S C. 33 C. 35

RibosomesRibosomes P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG