Bioinformatics and Comparative Genome Analysis Fredj Tekaia Institut Pasteur Introduction Bioinformatic and Comparative Genome Analysis.

Slides:

Advertisements

Similar presentations

Martin John Bishop UK HGMP Resource Centre Hinxton Cambridge CB10 1 SB

Advertisements

Course Advice for B. Science and B. Biomedicine students GENETICS MAJOR.

Unit 1: DNA and the Genome Key area 8: Genomic sequencing.

BIOINFORMATICS Ency Lee.

Bioinformatics and Genome Data Analysis Fredj Tekaia Institut Pasteur Introduction to the course.

1 Genetics The Study of Biological Information. 2 Chapter Outline DNA molecules encode the biological information fundamental to all life forms DNA molecules.

Advanced Course on Bioinformatics and Comparative Genome Analysis Fredj Tekaia Institut Pasteur Introduction.

Bio-bio-1 Team Advisor: Dr. Supten Sarbadhikari Members: Fokhruz Zaman Zohirul Alam Tiemoon Saddam Hossain Farjana Khatun.

Bibliographic Resources Fredj Tekaia Institut Pasteur EMBO Bioinformatics and Comparative Genome Analyses Course Institut Pasteur Paris.

BI420 – Course information Web site: Instructor: Gabor Marth Teaching.

Many genes have unknown function 30% have unknown function only 9% are experimentally verified The Arabidopsis Genome Initiative, Nature 2000 of the 25,498.

Roberto Bruzzone HKU-Pasteur Research centre Bioinformatic and Comparative Genome Analysis Course HKU-Pasteur Research Centre - Hong Kong, China August.

Bioinformatics in the Biology Curriculum Gloria Rendon NCSA July 2008.

Luxembourg, Sep 2001 Pedro Fernandes Inst. Gulbenkian de Ciência, Oeiras, Portugal EMBER A European Multimedia Bioinformatics Educational Resource.

From T. MADHAVAN, & K.Chandrasekaran Lecturers in Zoology.. EXIT.

 Scientific study of life.  Present era is most exciting in biology  Scientists are trying to solve biological puzzles like:  How a single microscopic.

9/30/2004TCSS588A Isabelle Bichindaritz1 Introduction to Bioinformatics.

Bioinformatics and Comparative Genome Analysis Fredj Tekaia Institut Pasteur Course Introduction:

Computational Methods to study Sequencing data -Meenakshi Sharma.

Development of Bioinformatics and its application on Biotechnology

1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.

© life_edu Lecture 22 Part IIa. Pharmaceutical Biotechnology in the Genomics Era Issues in Biotechnology: The Way We Work With Life Dr. Albert P. Kausch.

Introduction to Bioinformatics Prologue. Bioinformatics Living things have the ability to store, utilize, and pass on information Bioinformatics strives.

Supporting bioinformatics education in the Asia-Pacific Shoba Ranganathan Professor and Chair – Bioinformatics Dept. of Chemistry and Biomolecular Sciences.

Ch. 1: Exploring Life. 1.Organization -The basic characteristic of life is a high degree of order. -Hierarchy of structural levels: Biosphere  Ecosystems.

5 to 100 million species of organisms on Earth. All organisms on Earth are genetically related.

Chapter 24: Molecular and Genomic Evolution CHAPTER 24 Molecular and Genomic Evolution.

Introduction to Bioinformatics (Lecture for CS397-CXZ Algorithms in Bioinformatics) Jan. 21, 2004 ChengXiang Zhai Department of Computer Science University.

Biological Signal Detection for Protein Function Prediction Investigators: Yang Dai Prime Grant Support: NSF Problem Statement and Motivation Technical.

AdvancedBioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2002 Mark Craven Dept. of Biostatistics & Medical Informatics.

WMU CS 6260 Parallel Computations II Spring 2013 Presentation #1 about Semester Project Feb/18/2013 Professor: Dr. de Doncker Name: Sandino Vargas Xuanyu.

Bioinformatics and Comparative Genome Analyses Course Course web page: EMBO Bioinformatics and Comparative.

Pathogenomics How this project began: Ann Rose - take advantage of DNA sequence information - genomics Julian Davies - use the information to understand.

CHAPTER 1 INTRODUCTION: THEMES IN THE STUDY OF LIFE.

Bioinformatics and Computational Biology

Overview of Bioinformatics Module Denis Manley.. Contact Details Lecturer Name: Denis Manley Room number: KE-1-013a

From your notebook and/or glossary select 5 key terms from KA 1.7 and write each one on a study card. On the reverse write a meaning or explanation of.

Chapter 21 Genomes and Their Evolution. Genomics ______________ is a new approach to biology concerned with the study of the ___________ set of __________.

Bioinformatics Chem 434 Dr. Nancy Warter-Perez Computer Engineering Dr. Jamil Momand Chemistry & Biochemistry.

Bioinformatics Dipl. Ing. (FH) Patrick Grossmann

An Introduction to NCBI & BLAST National Center for Biotechnology Information Richard Johnston Pasadena City College.

Evolution and the Foundations of Biology

Biotechnology and Bioinformatics: Bioinformatics Essential Idea: Bioinformatics is the use of computers to analyze sequence data in biological research.

Higher Human Biology Unit 1 Human Cells KEY AREA 5: Human Genomics.

Protein Evolution Introducing the use of Biology Workbench as a Bioinformatics Tool.

1 Modelling and Simulation EMBL – Beyond Molecular Biology Physics Computational Biology Chemistry Medicine.

DNA Technology Using advances in DNA to solve problems.

Bioinformatics What is a genome? How are databases used? What is a phylogentic tree?

Introduction to Bioinformatics and Functional Genomics

Biological Databases By: Komal Arora.

Bioinformatics Madina Bazarova. What is Bioinformatics? Bioinformatics is marriage between biology and computer. It is the use of computers for the acquisition,

Higher Biology Genomic Sequencing Mr G R Davidson.

LEARN WHY COMPUTERS ARE REVOLUTIONIZING BIOLOGY!

New genes can be added to an organism’s DNA.

Molecular Phylogenetics

Genomes and Their Evolution

Genome organization and Bioinformatics

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

The Future of Genetic Research

Chapter 26.5: Horizontal Gene Transfer

The Study of Biological Information

Introduction to Bioinformatic

Evolution of Genomes Chapter 21.

Unit Genomic sequencing

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Introduction to Bioinformatics

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Presentation transcript:

Bioinformatics and Comparative Genome Analysis Fredj Tekaia Institut Pasteur Introduction Bioinformatic and Comparative Genome Analysis Course HKU-Pasteur Research Centre - Hong Kong, China August 17 - August 29, 2009 Bioinformatic and Comparative Genome Analysis Course HKU-Pasteur Research Centre - Hong Kong, China August 17 - August 29, 2009

Bioinformatics and Comparative Genome Analysis August 16 - August 29, 2009 HKU-Pasteur Research Centre - Hong Kong Course web page: Organizers/Contact: Roberto Bruzzone, HKU-Pasteur Research Centre - Hong Kong; Si Lok, Genome Research Centre the University of Hong Kong; Tin Wee Tan, National University of Singapore - Singapore; Ueng-Cheng Yang, National Yang-Ming University, Taipei - Taiwan; Fredj Tekaia, Institut Pasteur Paris, France.

Why this course ?

Tree of life Complete genomes 5207 projects 1069 published ( ) 2755 Bacteria 107 Archaea 1108 Eukaryotes 168 metagenomes 3 phylogenetic domains; Lifestyles: mesophiles; (hyper)thermophiles; psychrophiles; extreme conditions,...

Number of completely sequencing genome projects GOLD Completely sequencing Genomes that span the three domains of life are growing at a rapid rate projects

Genome studies show that: Access to entire genome sequences has revolutionized our understanding of how genetic information is stored and organized in DNA, and how it has evolved over time. The sequence of a genome provides significant details of the gene catalogue within a species. Comparisons of complete genome sequences show the acceleration in the understanding of species organisation, links between genes, functions of the genes, evolution of genes, genomes and species. => Beyond fundamental biological and methodological interests, Expected applications include: Drug, Medical and Agricultural,… discoveries… and their health and economical concequences.

Few scientists are involved in generating data and much more are involved in data analyses

Genomics Is the study of genomes. (including the study of their genes, proteins, their sequences, functions, evolution,....)

Bioinformatics is needed to transform the flood of raw data (sequences) into scientific knowledge.

MathematicsStatistics Nucleotide & protein sequences and related informations Informatics Biology Bioinformatics

Information system: Bibliography

Bibliography:

The main objectives of the course are to familiarize the selected students with bioinformatics and large scale genome data analyses skills by introducing: 1- advanced fundamental algorithms in Bioinformatics; 2- their application in genome analyses; 3- recent knowledge acquired from genomes studies and their perspectives. Bioinformatics and Comparative Genome Analysis

Enjoy this exiting course and your stay in Hong Kong