How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule into bacteria -Amplify DNA by culturing transformed bacteria -Use transformants for variety of purposes ( e.g. expression studies, sequencing, mutational analysis, etc.) -Select for transformants

LE 20-2 Bacterium Bacterial chromosome Plasmid Gene inserted into plasmid Cell containing gene of interest Gene of interest DNA of chromosome Recombinant DNA (plasmid) Plasmid put into bacterial cell Recombinant bacterium Host cell grown in culture to form a clone of cells containing the “cloned” gene of interest Protein expressed by gene of interest Protein harvested Gene of interest Copies of gene Basic research on gene Basic research on protein Basic research and various applications Gene for pest resistance inserted into plants Gene used to alter bacteria for cleaning up toxic waste Protein dissolves blood clots in heart attack therapy Human growth hor- mone treats stunted growth

Restriction Enzymes Used to Make Recombinant DNA Bacterial restriction enzymes – cut DNA molecules at specific DNA sequences called restriction sites

LE 20-3 Restriction site DNA Restriction enzyme cuts the sugar-phosphate backbones at each arrow. One possible combination DNA fragment from another source is added. Base pairing of sticky ends produces various combinations. Fragment from different DNA molecule cut by the same restriction enzyme DNA ligase seals the strands. Recombinant DNA molecule Sticky end EcoRI Memorize EcoRI restriction site palindrome Catalyzes phosphodiester bond between 5’ phosphate & 3’ hydroxyl group of sugar Ligation

Do restriction digests and ligations always work? What are the other possible undesirable outcomes?

Clever way to select for recombinant clones Plasmid contains LacZ gene-->  -galactosidase X-gal (substrate:one product is blue) Blue colonies Restriction site in LacZ gene if insert DNA fragment  -galactosidase X-gal White colonies What is a common strategy to select for transformed bacteria? Grow bacteria on antibiotic: only plasmid carriers will survive

LE 20-4_3 Isolate plasmid DNA and human DNA. Cut both DNA samples with the same restriction enzyme. Mix the DNAs; they join by base pairing. The products are recombinant plasmids and many nonrecombinant plasmids. Bacterial cell lacZ gene (lactose breakdown) Human cell Restriction site amp R gene (ampicillin resistance) Bacterial plasmid Gene of interest Sticky ends Human DNA fragments Recombinant DNA plasmids Introduce the DNA into bacterial cells that have a mutation in their own lacZ gene. Recombinant bacteria Plate the bacteria on agar containing ampicillin and X-gal. Incubate until colonies grow. Colony carrying non- recombinant plasmid with intact lacZ gene Colony carrying recombinant plasmid with disrupted lacZ gene Bacterial clone

Different goals in creating recombinant clones 1.To examine/utilize the structure and function of a single piece of DNA. 2. To package small pieces of an entire genome: genomic DNA library To have available all the sequences in the genome for examination and use.

LE 20-6 Bacterial clones Recombinant plasmids Recombinant phage DNA or Foreign genome cut up with restriction enzyme Phage clones Plasmid libraryPhage library DNA libraries created using plasmids and phage and bacterial hosts Note: practical limit on the size of DNA cloned into a vectors (plasmid: 5-10 kbp, phage: 45 kbp)

Characterization of DNA by Size Agarose Gel Electrophoresis Digest DNA with restriction enzymes Load DNA into wells of agarose gel Apply electric current to fractionate DNA fragments by size In electric field with positive and negative poles, which pole will DNA be attracted to? Why? How to distinguish one DNA molecule from another?

LE 20-8 Cathode Power source Anode Mixture of DNA molecules of differ- ent sizes Gel Glass plates Longer molecules Shorter molecules -DNA stained with fluorescent dye (ethidium bromide) -DNA fluoresces upon exposure to ultraviolet (UV) light

How would you determine whether a particular gene or DNA sequence is present in your cloned DNA? Southern Blot

LE DNA + restriction enzyme Restriction fragments  Normal  -globin allele  Sickle-cell allele  Heterozygote Preparation of restriction fragments.Gel electrophoresis.Blotting.  Nitrocellulose paper (blot) Gel Sponge Alkaline solution Paper towels Heavy weight Hybridization with radioactive probe.  Radioactively labeled probe for  -globin gene is added to solution in a plastic bag Paper blot Probe hydrogen- bonds to fragments containing normal or mutant  -globin Fragment from sickle-cell  -globin allele Fragment from normal  -globin allele Autoradiography.  Film over paper blot Southern Blot Analysis Labeled nucleic acid probe: RNA or DNA

Why are globin DNA fragments different in size?

LE 20-9 Normal  -globin allele 175 bp201 bpLarge fragment Sickle-cell mutant  -globin allele 376 bpLarge fragment Ddel Ddel restriction sites in normal and sickle-cell alleles of  -globin gene Normal allele Sickle-cell allele Large fragment 376 bp 201 bp 175 bp Electrophoresis of restriction fragments from normal and sickle-cell alleles Restriction enzyme

Restriction Fragments Length Polymorphisms (RFLP) - useful in detecting disease alleles -forensics to identify individuals no two individuals are alike (exception?)

LE Defendant’s blood (D) Blood from defendant’s clothes Victim’s blood (V) Do the RFLPs suggest the defendant was in contact with the victim? By themselves, do RFLPS prove she’s guilty of assault?

Genomics and Molecular Techniques Characterization of entire genomes Human Genome Project (HPG): ambitious goal to sequence the entire human genome (initiated 1990; mostly complete 2003) Other genomes also sequenced Evolutionary relatedness of key interest ->sequence comparison Ch 20

LE Cytogenetic map Genes located by FISH Chromosome bands Genetic markers Genetic (linkage) mapping Physical mapping Overlapping fragments DNA sequencing Steps in genome mapping (chromosome map)

DNA Sequencing Short DNA fragments sequenced by dideoxy chain-termination method

LE DNA (template strand) 5 3 Primer 3 5 DNA polymerase DeoxyribonucleotidesDideoxyribonucleotides (fluorescently tagged) 3 5 DNA (template strand) Labeled strands 3 Direction of movement of strands LaserDetector DNA chain terminators

Other approach to genome sequencing: –Shotgun method Sequence random fragments of DNA Computer program orders overlapping fragments into single continuous sequence

LE Cut the DNA from many copies of an entire chromosome into overlapping frag- ments short enough for sequencing Clone the fragments in plasmid or phage vectors Sequence each fragment Order the sequences into one overall sequence with computer software

Genome organization Gene expression patterns in response to - environmental change e.g. pollution, global warming -Development embryogenesis-> senescence -Disease/Health Can we learn important information from the genome sequence?

Computer Analysis: Key Tool Bioinformatics -analysis and storage of biological data by computing techniques -key to management & analysis of huge data sets Example: Identification of proteins coding sequences (ORF) in genomes agatactagcagctctttcgagcatcagcatcaccgatgcatcgatcacgcgctgtttg…

Think of a sequence feature that a program could search for to identify ORFs.

? ? ? ? ? ? ?