13.2 Ribosomes and Protein Synthesis

Slides:



Advertisements
Similar presentations
RNA and Protein Synthesis
Advertisements

1 Review How does a cell interpret the genetic code Explain What are codons and anticodons 2 Review What happens during translation Compare and Contrast.
Translation Proteins are made by joining amino acids into long chains called polypeptides (proteins). Each polypeptide contains a combination of any or.
RNA and Protein Synthesis
13.2 Ribosomes and Protein Synthesis
RNA and Protein Synthesis
10-2: RNA and 10-3: Protein Synthesis
RNA Transcription.
What organic molecule is DNA? Nucleic Acid. An organic molecule containing hydrogen, oxygen, nitrogen, carbon, and phosphorus Examples: DNA ???? RNA.
Protein and Translation. Central Dogma of Biology _____________________________________: -Transcription: The decoding of DNA into mRNA -Translation: The.
Lesson Overview 13.1 RNA.
Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis
Lesson Overview 13.1 RNA.
RNA and Protein Synthesis
13.2 Ribosomes and Protein Synthesis
Chapter 13: RNA and Protein Synthesis
Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis
The Genetic Code.
Lesson Overview Lesson Overview Ribosomes and Protein Synthesis Objectives 13.2 Ribosomes and Protein Synthesis - Identify the genetic code and explain.
RNA & DNA Compare RNA & DNA Contrast RNA & DNA
RNA & Protein Synthesis
CHAPTER 13 RNA and Protein Synthesis. Differences between DNA and RNA  Sugar = Deoxyribose  Double stranded  Bases  Cytosine  Guanine  Adenine 
8-2 DNA Structure & Replication  DNA - Carries information about heredity on it genes.  Deoxyribonucleic Acid  belongs to the class of macromolecules.
PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.
Ribosomes and Protein Synthesis. Learning Objectives  Identify the genetic code and explain how it is read.  Summarize the process of translation. 
Welcome to class 1/19/16 – 1/20/16  Turn in Check for understanding (3 of them)  Warm up  Notes on RNA and Transcription process  Complete check.
RNA & Protein Synthesis Continued: Translation. Translation: mRNA Protein Translation is taking mRNA and making proteins Sequence of nucleotide bases.
13.1 RNA 13.2 Ribosomes & Protein Synthesis
Chapter 13 – RNA & Protein Synthesis MS. LUACES HONORS BIOLOGY.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
Gene Expression DNA, RNA, and Protein Synthesis. Gene Expression Genes contain messages that determine traits. The process of expressing those genes includes.
Lesson Overview Lesson Overview The Structure of DNA Nucleic Acids and Nucleotides Nucleic acids are long, slightly acidic molecules originally identified.
Chapter 13 From DNA to Proteins
13.2 Ribosomes and Protein Synthesis
13.2 Ribosomes and Protein Synthesis
13.2 Ribosomes and Protein Synthesis
From DNA to Proteins Lesson 1.
Copyright Pearson Prentice Hall
12-3 RNA & Protein Synthesis
12-3 RNA and Protein Synthesis
13.2 Ribosomes and Protein Synthesis
13.2 Ribosomes and Protein Synthesis
Ribosomes and Protein Synthesis
Ribosomes and Protein Synthesis (Ch 13.2)
Bellwork: How does a cell interpret the genetic code
12-3 RNA and Protein Synthesis
What is RNA? Do Now: What is RNA made of?
12-3 RNA and Protein Synthesis
RNA and Protein Synthesis
Ribosomes and Protein Synthesis
Translation The sequence of nucleotide bases in an mRNA molecule is a set of instructions that gives the order in which amino acids should be joined to.
13.2 Ribosomes and Protein Synthesis
Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.
13.2 Ribosomes and Protein Synthesis
13.2 Ribosomes and Protein Synthesis
13.2 Ribosomes and Protein Synthesis
RNA & Protein synthesis
12-3 RNA and Protein Synthesis
13.2 Ribosomes and Protein Synthesis
Comparing RNA and DNA Each nucleotide in both DNA and RNA is made up of a 5-carbon sugar, a phosphate group, and a nitrogenous base. There are three important.
I will understand the general pathway of transcription and translation
Lesson Overview 13.1 RNA.
13.2 Ribosomes and Protein Synthesis
Ribosomes and Protein Synthesis
Genes and Protein Synthesis Review
13.2 Ribosomes and Protein Synthesis
13.2 Ribosomes and Protein Synthesis
4a. Know the general pathway by which ribosomes synthesize proteins, using tRNAs to translate genetic information in mRNA.
Translation The sequence of nucleotide bases in an mRNA molecule is a set of instructions that gives the order in which amino acids should be joined to.
Presentation transcript:

13.2 Ribosomes and Protein Synthesis Lesson Overview 13.2 Ribosomes and Protein Synthesis

THINK ABOUT IT How would you build a system to read the messages that are coded in genes and transcribed into RNA? Would you read the bases one at a time, as if the code were a language with just four words—one word per base? Perhaps you would read them as individual letters that can be combined to spell longer words.

The Genetic Code What is the genetic code, and how is it read?

The Genetic Code What is the genetic code, and how is it read? The genetic code is read three “letters” at a time, so that each “word” is three bases long and corresponds to a single amino acid.

The Genetic Code The first step in decoding genetic messages is to transcribe a nucleotide base sequence from DNA to RNA. This transcribed information contains a code for making proteins.

The Genetic Code Proteins are made by joining amino acids together into long chains, called polypeptides. As many as 20 different amino acids are commonly found in polypeptides.

The Genetic Code The specific amino acids in a polypeptide, and the order in which they are joined, determine the properties of different proteins. The sequence of amino acids influences the shape of the protein, which in turn determines its function.

The Genetic Code RNA contains four different bases: adenine, cytosine, guanine, and uracil. These bases form a “language,” or genetic code, with just four “letters”: A, C, G, and U.

The Genetic Code Each three-letter “word” in mRNA is known as a codon. A codon consists of three consecutive bases that specify a single amino acid to be added to the polypeptide chain.

How to Read Codons Because there are four different bases in RNA, there are 64 possible three-base codons (4 × 4 × 4 = 64) in the genetic code. This circular table shows the amino acid to which each of the 64 codons corresponds. To read a codon, start at the middle of the circle and move outward.

How to Read Codons Most amino acids can be specified by more than one codon. For example, six different codons—UUA, UUG, CUU, CUC, CUA, and CUG—specify leucine. But only one codon—UGG—specifies the amino acid tryptophan.

Start and Stop Codons The genetic code has punctuation marks. The methionine codon AUG serves as the initiation, or “start,” codon for protein synthesis. Following the start codon, mRNA is read, three bases at a time, until it reaches one of three different “stop” codons, which end translation.

Translation What role does the ribosome play in assembling proteins?

Translation What role does the ribosome play in assembling proteins? Ribosomes use the sequence of codons in mRNA to assemble amino acids into polypeptide chains.

Translation The sequence of nucleotide bases in an mRNA molecule is a set of instructions that gives the order in which amino acids should be joined to produce a polypeptide. The forming of a protein requires the folding of one or more polypeptide chains. Ribosomes use the sequence of codons in mRNA to assemble amino acids into polypeptide chains. The decoding of an mRNA message into a protein is a process known as translation.

Steps in Translation Messenger RNA is transcribed in the nucleus and then enters the cytoplasm for translation.

Steps in Translation Translation begins when a ribosome attaches to an mRNA molecule in the cytoplasm. As the ribosome reads each codon of mRNA, it directs tRNA to bring the specified amino acid into the ribosome. One at a time, the ribosome then attaches each amino acid to the growing chain.

Steps in Translation Each tRNA molecule carries just one kind of amino acid. In addition, each tRNA molecule has three unpaired bases, collectively called the anticodon—which is complementary to one mRNA codon. The tRNA molecule for methionine has the anticodon UAC, which pairs with the methionine codon, AUG.

Steps in Translation The ribosome has a second binding site for a tRNA molecule for the next codon. If that next codon is UUC, a tRNA molecule with an AAG anticodon brings the amino acid phenylalanine into the ribosome.

Steps in Translation The ribosome helps form a peptide bond between the first and second amino acids—methionine and phenylalanine. At the same time, the bond holding the first tRNA molecule to its amino acid is broken.

Steps in Translation That tRNA then moves into a third binding site, from which it exits the ribosome. The ribosome then moves to the third codon, where tRNA brings it the amino acid specified by the third codon.

Steps in Translation The polypeptide chain continues to grow until the ribosome reaches a “stop” codon on the mRNA molecule. When the ribosome reaches a stop codon, it releases both the newly formed polypeptide and the mRNA molecule, completing the process of translation.

The Roles of tRNA and rRNA in Translation Ribosomes are composed of roughly 80 proteins and three or four different rRNA molecules. These rRNA molecules help hold ribosomal proteins in place and help locate the beginning of the mRNA message. They may even carry out the chemical reaction that joins amino acids together.

The Molecular Basis of Heredity What is the “central dogma” of molecular biology?

The Molecular Basis of Heredity What is the “central dogma” of molecular biology? The central dogma of molecular biology is that information is transferred from DNA to RNA to protein.

The Molecular Basis of Heredity Most genes contain instructions for assembling proteins.

The Molecular Basis of Heredity Many proteins are enzymes, which catalyze and regulate chemical reactions. A gene that codes for an enzyme to produce pigment can control the color of a flower. Another gene produces proteins that regulate patterns of tissue growth in a leaf. Yet another may trigger the female or male pattern of development in an embryo. Proteins are microscopic tools, each specifically designed to build or operate a component of a living cell.

The Molecular Basis of Heredity Molecular biology seeks to explain living organisms by studying them at the molecular level, using molecules like DNA and RNA. The central dogma of molecular biology is that information is transferred from DNA to RNA to protein. There are many exceptions to this “dogma,” but it serves as a useful generalization that helps explain how genes work.

The Molecular Basis of Heredity Gene expression is the way in which DNA, RNA, and proteins are involved in putting genetic information into action in living cells. DNA carries information for specifying the traits of an organism. The cell uses the sequence of bases in DNA as a template for making mRNA.

The Molecular Basis of Heredity The codons of mRNA specify the sequence of amino acids in a protein. Proteins, in turn, play a key role in producing an organism’s traits.

The Molecular Basis of Heredity One of the most interesting discoveries of molecular biology is the near-universal nature of the genetic code. Although some organisms show slight variations in the amino acids assigned to particular codons, the code is always read three bases at a time and in the same direction. Despite their enormous diversity in form and function, living organisms display remarkable unity at life’s most basic level, the molecular biology of the gene.