SSR

SSR SSR is also known as microsatellite or short tandem repeat (STR). segment of DNA consists of tandemly repeated unit, each between 1 and 10 base-pairs in length, such as (TG)n or (AAT)n. (TG)8 = TGTGTGTGTGTGTGTG (AAT)6 = AATAATAATAATAATAAT (CA)8

SSR it was studied in human (1989), and was found to be common in plants and animals. they are widely dispersed throughout eukaryotic genomes and often highly polymorphic due to variation in the number of repeat units. it shows high level of intra and interspecific variation. these high rates of mutation can be explained most frequently by slipped strand mispairing (slippage) during DNA replication. mutation may also occur during recombination during meiosis.

Types of SSR (A)n, (T)n, (C)n, (G)n – mononucleotide SSRs (AT)n, (CG)n, (GT)n – dinucleotide SSRs (ATT)n, (CCG)n, (GTA)n – trinucleotide SSRs (CCGG)n, (TATC)n – tetranucleotide SSRs

Types of SSR Compound SSRs: ATATATATCACACAATATATATCACACA - (AT)4(CA)3 CCGCCGATATATATCCGCCGATATATAT - (CCG)3(AT)4

Types of SSR Perfect SSR motifs: AAAAAAAAAAAA - (A)12 ATATATATATATATATAT - (AT)9 CCGCCGCCGCCGCCGCCGCCG - (CCG)7 Imperfect SSR motifs: AAAAATAAAAAAAA - (A)14 ATATATATACATATATAT - (AT)9

How to detect SSR? these tandemly repeated units are usually franked by unique conserved sequences. Therefore, primers could be designed to amplify the SSRs.

detection of variation in SSR can be done using metaphor agarose gel or polyacrylamide gel. variation between individuals is because of different alelles due to the number of tandemly repeated units.

Characteristics of SSR each SSR is controlled by one locus. each locus is controlled by many alleles (2-16 alleles). mutational rates are high in microsatellite regions. it is co-dominantly inherited. the franking regions of SSR are conserved within species.

Stutter Bands in SSR very often there are minor bands in addition to the major bands. These minor bands are called stutter bands (shadow bands) and they usually differ (smaller in size) from the major bands by a few nucleotides. these stutter bands arise from slipped-strand mispairing during PCR.

SSR PCR amplification protocols used for SSRs are general standard. several PCR products (different SSR loci) can be pooled (multiplexing) for electrophoresis. Multiplexing allows rapid genotyping of large sample sizes across several loci.

Multiplexing in SSRs Locus A Locus B

EST-SSR EST (Expressed Seqeunce Tag) sequences are generated from cDNA (may be derived from cDNA library). these ESTs may contain SSR motifs. Tandem Repeat Finder (a computer software) is normally used to screen SSR motifs from ESTs. the SSR derived from EST is called EST-SSR. They normally contain trinucleotide repeat units. primers to amplify EST-SSR are designed based on the EST sequence franking the SSR motif. EST-SSR is particularly useful for QTL mapping.

Transferability of SSRs SSR primers developed for one particular species are normally applicable across wide range of related species. Examples: SSR transferability from lychee to pulasan is 58% SSR transferability from lychee to logan is 92% the rate of transferability depends on the evolutionary distance and the complexity of the genome of the species. transferability is normally higher for EST-SSRs compared to SSRs.

SSR Disadvantage: high cost in developing the SSR primers. Advantage: primers developed for one particular species are normally applicable across wide range of related species.