CHROMOSOME FUSION?. WHAT IS MOST STRIKING HERE? Compare the Banding Patterns: 6 longest chromosomes of humans (Hu), are matched with 7 chromosomes from.

Slides:



Advertisements
Similar presentations
Time to Abandon Darwin? Answering the Challenge from design Kenneth R. Miller Brown University.
Advertisements

One-Gene-One-Enzyme, Pseudogenes & Common Ancestry
Journal Question 18 Dec 2012 Describe the relationship between: DNA Chromosomes Genes, and Traits.
Evolution The Unifying Theory of Biology Contemporary Scientific History of the Universe billion.
Mystery of the Matching Marks 2 DO I HAVE YOUR ATTENTION? For some reason, a GUNSHOT seems to suggest a CRIME SCENE… with BULLETS … and BULLET MARKS.
Mystery of the Matching Marks (Part 3) 2 DNA Search Lab Followup Welcome back from your SEARCH FOR THE TELL-TALE TELOMERE Let’s see what it tells us…
Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC.
Genetica per Scienze Naturali a.a prof S. Presciuttini Human and chimpanzee genomes The human and chimpanzee genomes—with their 5-million-year history.
Chromosomes and Diseases Genetics MBG-210. How many chromosomes in humans? Theophilus Painter in 1921 characterized the number of chromosomes as 24 on.
Mystery of the Matching Marks part 2. Let’s look at our two sets of chromosomes again, side-by-side. This time, Focus on their DIFFERENCES: What do you.
Human Evolution How did we get here?. Controversy 1871 Darwin published a second book “The Descent of Man” Argued humans are related to African Apes (gorilla.
Evidence of Evolution by Natural Selection
More Historical Evidence The study of Homologies.
Evolution: Fact and Theory  Fact: Species change over time.  Theory: Species arise from common descent through natural selection  Random mutations lead.
Regents Biology Witness to Evolution. Regents Biology Witness to Evolution  Peppered Moth  2 types: dark vs. light Peppered moth light.
AP Biology Evidence of Evolution by Natural Selection Testable Hypotheses.
AP Biology Evidence of Evolution by Natural Selection Testable Hypotheses.
Does The Evidence Support Evolution? “More than a century ago, Darwin and Huxley posited that humans share recent common ancestors with the African great.
Evidence for Evolution
Recombinant DNA Technology and Genomics A.Overview: B.Creating a DNA Library C.Recover the clone of interest D.Analyzing/characterizing the DNA - create.
Molecular Evolution. The fact that all species utilize the same genetic code to synthesize proteins argues for a common ancestry to all life on earth.
Are humans descended from viruses?
Mystery of the Matching Marks DO I HAVE YOUR ATTENTION? For some reason, a GUNSHOT seems to suggest a CRIME SCENE… with BULLETS … and BULLET MARKS.
Differences in DNA Heterochromatin vs. Euchromatin
Primate Evolution Section 16.1 Primates. Daily Objective Understand that Primates share several behavioral and biological characteristics, which indicates.
Lesson 4-5 LCM: Least Common Multiple. Multiples A multiple is formed by multiplying a given number by the counting numbers. The counting numbers are.
Are We Really Related to Chimps?
1 Chromosome Evidence for Ancestry © 2008 Regents of the University of California. All rights reserved. Use for SGI Field Test only.
How Do Traits Get Passed On? LESSON 4. Move to which corner you think is correct for each question Can offspring get instructions for the variation of.
Evolution is the process of biological change by which descendants come to differ from their ancestors.
Opener – 6 minutes ▪ Copy the following the terms & definitions into your notebook: ▪ Archaeology – scientific study of ancient cultures through the examination.
DNA Questions What makes up a DNA backbone? How would you describe how DNA looks? Name the 4 bases that make up DNA. “T” base can only match with? What.
Mystery of the Matching Marks 2  For some reason, a GUNSHOT seems to suggest a CRIME SCENE… DO I HAVE YOUR ATTENTION? with BULLETS … and BULLET MARKS.
Looking Within Human Genome King abdulaziz university Dr. Nisreen R Tashkandy GENOMICS ; THE PIG PICTURE.
Human and Ape DNA Lab.
Mind Stretcher 2/14/17: What are these items used for?
Evidence of Evolution by Natural Selection
Evidence of Evolution by Natural Selection
Evidence of Evolution by Natural Selection
Does The Evidence Support Evolution?
Example of a common SNP in dogs
Genomes and Their Evolution
Evidence of Evolution by Natural Selection
Mystery of the Matching Marks part 2.
Evidence of Evolution by Natural Selection
Mystery of the Matching Marks.
CHROMOSOME CONNECTION
CHROMOSOME COMPARISONS
What kinds of things have been learned?
CLADISTICS Cladistic relationships are shown in a diagram called a_________________ CLADOGRAM Image from:
Lesson 3 Thursday, 11/14 AIM: What is a telomere?
CHROMOSOME COMPARISONS
CHROMOSOME FUSION?.
Evidence of Evolution by Natural Selection
Evidence of Evolution by Natural Selection
CHROMOSOME FUSION?.
CHROMOSOME COMPARISONS
Genetic Variation Lesson 42
Evidence of Evolution by Natural Selection
Sexual Reproduction and Genetic Variation
What Can Our Chromosomes Tell Us?
Witness to Evolution
4. _____________________
Evidence of Evolution by Natural Selection
Meiosis and Sexual Reproduction
Multiples and Factors Lesson 2.2.
Mystery of the Matching Marks part 2.
Evidence of Evolution by Natural Selection
Presentation transcript:

CHROMOSOME FUSION?

WHAT IS MOST STRIKING HERE? Compare the Banding Patterns: 6 longest chromosomes of humans (Hu), are matched with 7 chromosomes from three ape species.

WHY COLORED TIPS? Why are the chromosome tips colored?

CHROMOSOME PARTS All Chromosomes have telomeres at their ends (like shoelace aglets!) Head Telomere Centromere Tail Telomere Telomeres have a unique DNA sequence… ttagggttagggttagggttagggttagggttaggg… |||||||||||||||||||||||||||||||||||| aatcccaatcccaatcccaatcccaatcccaatccc…

Let’s Narrow Our Focus: 6 longest chromosomes of humans (Hu), matched with 7 chromosomes from chimpanzees ONLY (Ch)

MORE QUESTIONS… Why are TWO shorter chimp chromosomes needed to match our #2 chromosome? Could our #2 chromosome have formed by the FUSION of TWO shorter chromosomes found in chimpanzees today (#12 and #13)? LIKE THIS…?

Chimp #13 Chimp #12 Human #2

PREDICTION If fusion occurred, then we should see DNA evidence of the head-to-head telomeres together near middle of our #2 chromosome Chimp #12 Chimp #13 Human #2 Fusion Area?

DNA DNA Sequence for Telomeres: ttagggttagggttaggg… |||||||||||||||||| aatcccaatcccaatccc… Head Telomere Centromere Tail Telomere NOTICE: Tandem Repeats in Telomeres: ttagggttagggttaggg… |||||||||||||||||| aatcccaatcccaatccc… Repeated times in each Telomere

EXPECTATIONS What will you look for? tandem repeats in fusion area Where will you look for them? middle of our chromosome #2 How can you look for them? search online DNA database What if evidence is NOT found? fusion may not have happened

CHROMOSOME FUSION Read the lesson Do the lesson - Go online Discuss the results Explanation? STOP HERE CONTINUE ONLY AFTER DOING LESSON or if there’s no time to do the lesson

STOP HERE (Results follow)

RESULTS agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg

RESULTS CLARIFIED agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg HEAD 13 HEAD 12 See where the head-to-head fusion occurred?

WHY THE SUDDEN CHANGE? taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta HEAD 13 HEAD 12 Why do the TANDEM REPEATS suddenly change from ttaggg to ccctaa ? Why so many slight variations in the number of t’s, a’s, g’s, and c’s in each repeat? DO THE LESSON, and find out!

WHY SO FEW REPEATS? gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg HEAD 13 HEAD 12 Count the TANDEM REPEATS in both telomere segments. (only about 37 ttaggg repeats in Head 13; about 88 ccctaa repeats in Head 12) Should be 800 to 1600 repeats, so… Why so many FEWER than typically found in telomeres? DO THE LESSON and find out!

Further Confirmation Comparison of DNA in Our Chrom. #2 with...

Another Confirmation Comparison of DNA in Our Chrom. #3 with...

Re-Check Banding Patterns Compare other chromosomes online: Human with Chimp, Dog…

MULTIPLE EVIDENCE Compare hominoid chromosomes Compare hominoid skulls Study pattern of hominid chronology Compare primate hemoglobins What do ALL of these patterns suggest? DO THE LABS!