Students ± PV92 Alu Insert. Transposons are “mobile genetic elements” of which there are a great many kinds. Some jump around in genomes. Others jump,

Slides:



Advertisements
Similar presentations
Site-specific recombination
Advertisements

LINEs and SINEs ….& towards cancer! Presenter: Manindra Singh Course: MCB 720 (Winter Qt.)
Genomics – The Language of DNA Honors Genetics 2006.
Chapter 7b - Transposable elements:
Chap. 6 Problem 2 Protein coding genes are grouped into the classes known as solitary (single) genes, and duplicated or diverged genes in gene families.
Retroviruses And retroposons
Retroviruses and Retroposons Chapter Introduction Figure 22.1.
Transposons & Mechanisms of Transposition
Copyright, ©, 2002, John Wiley & Sons, Inc.,Karp/CELL & MOLECULAR BIOLOGY 3E The Stability of the Genome Duplication, Deletion, Transposition.
Long Interspersed Nucleotide Elements (LINEs) Rami Al-Ouran.
Chapter 23 Catalytic RNA Introduction 23.2 Group I introns undertake self-splicing by transesterification 23.3 Group I introns form a characteristic.
GENE DUPLICATIONS A.Non-homologous recombination B.Transposition C.Non-disjunction in meiosis.
Genomic Repetitive Elements (Human Focus). TYPES OF ELEMENTS Tandem repeats: a) satellite DNA 1) centromeric and heterochromatic 2) minisatellite 3) microsatellite.
Molecular Biology Fourth Edition
Transposition and transposable elements
Genomes summary 1.>930 bacterial genomes sequenced. 2.Circular. Genes densely packed Mbases, ,000 genes 4.Genomes of >200 eukaryotes (45.
Retroviruses and Retroposons
Online Counseling Resource YCMOU ELearning Drive… School of Architecture, Science and Technology Yashwantrao C havan Maharashtra Open University, Nashik.
Introduction Basic Genetic Mechanisms Eukaryotic Gene Regulation The Human Genome Project Test 1 Genome I - Genes Genome II – Repetitive DNA Genome III.
Human Genetics The Human Genome 1.
PV92 PCR/Informatics Kit
Transposition Evidence Mechanisms: DNA-mediated RNA-mediated.
Selfish DNA Honors Genetics.
Eukaryotic Genomes Demonstrate Sequence Organization Characterized by Repetitive DNA Honors Genetics Lemon Bay High School
Genomes and Their Evolution. GenomicsThe study of whole sets of genes and their interactions. Bioinformatics The use of computer modeling and computational.
Transposon and Mechanisms of Transposition
DNA Recombination.
Fig Genome = Genic + Intergenic (or non-genic) Eukaryotic genomes: composition of human genome.
Genomes & their evolution Ch 21.4,5. About 1.2% of the human genome is protein coding exons. In 9/2012, in papers in Nature, the ENCODE group has produced.
A unified classification system for eukaryotic transposable elements
BACTERIAL TRANSPOSONS
Lecture 9 Site Specific Recombination and Transposition Quiz 5 due today at 4 PM.
Introduction to Molecular Genetics Studiju materiāli / MolekularasBiologijas / Ievads MolGen / EN.
HA Hong-seok, HUH Jae-Won, KIM Dae-Soo 1, JOO Myung-Jin 2 and KIM Heui-Soo* Division of Biological Sciences, College of Natural Sciences, Pusan National.
Nonviral Retroposon LINE Element 지도 교수 : 김 희 수 교수님 발 표 자 : 문 요 섭 참 가 자 : 김 영 균, 윤 성 용 제 4 회 부산대학교 생물학과 학술제.
Mobile DNA  Transposons By Anna Purna
Expression of the Viral Genome in Host Cells (How do viruses express their genomes?)
Bacterial Transposons Author Meenakshi Agarwal, Mehta Gunjan Mentor Dr. Santanu Ghosh.
‘mobile’ DNA or ‘jumping’ DNA Transposable elements as drivers of evolution.
Alu Elements PCR Workshop Instruction manuals that come with new gadgets are notoriously frustrating…but at least they do not insert, just when.
Retroviruses and Trans(retro)posons
Course 72332, mobile DNA : Evolutionary changes in genetic information Pages to read: Lodish (Ch. 10.3),
Homologous Recombination
 DNA- genetic material of eukaryotes.  Are highly variable in size and complexity.  About 3.3 billion bp in humans.  Complexity- due to non coding.
Objective: I can explain how genes jumping between chromosomes can lead to evolution. Chapter 21; Sections ; Pgs Genomes: Connecting.
Retroviruses and Trans(retro)posons
Sridaran Dhivya, Kumpati Premkumar 
Transposable Elements
Alu insert, PV92 locus, chromosome 16
Lecture 2 – Repeat elements
Gene-related Sequence
Genomes and Their Evolution
SGN23 The Organization of the Human Genome
Genomes and Their Evolution
2013 Curt Stern Award Address1
Evolution of eukaryote genomes
Genomes and Their Evolution
Genomes and Their Evolution
Organization of the human genome
L1 Mosaicism in Mammals: Extent, Effects, and Evolution
High Frequency Retrotransposition in Cultured Mammalian Cells
Genomes and Their Evolution
Genomes and Their Evolution
Genomes and Their Evolution
Transposable Elements
Genomes and Their Evolution
Human Transposon Tectonics
Organization of TCAST elements within T
Genomes and Their Evolution
Presentation transcript:

Students ± PV92 Alu Insert

Transposons are “mobile genetic elements” of which there are a great many kinds. Some jump around in genomes. Others jump, but also leave behind copies. Others help their relatives jump. The illustration of generic transposition to the right provides a model of how transposons can lead to genetic disease.

a | Approximately 45% of the human genome can currently be recognized as being derived from transposable elements, the majority of which are non-long terminal repeat (LTR) retrotransposons, such as LINE-1 (L1), Alu and SVA elements. b | The canonical L1 element consists of two open reading frames (ORF1 and ORF2) flanked by 5' and 3' UTRs. The 5' UTR possesses an internal RNA polymerase II promoter (blue box). The element ends with an oligo(dA)-rich tail (AAA) preceded by a polyadenylation signal (pA). The canonical Alu element consists of two related monomers separated by an A-rich linker region (with consensus sequence A5TACA6). The left monomer contains A and B boxes (blue boxes), which are transcriptional promoters for RNA polymerase III. The element ends with an oligo(dA)- rich tail (AAA) that can be up to 100 bp long. The canonical SVA element has a composite structure consisting of (from the 5' end to 3' end): a (CCCTCT)n hexamer repeat region; an Alu-like region consisting of two antisense Alu fragments and an additional sequence of unknown origin; a variable number of tandem repeats (VNTR) region made of units 35–50 bp in length; and a region derived from the envelope polyprotein (env) gene and the 3' LTR of human endogenous retrovirus (HERV)-K10. The element ends with an oligo(dA)-rich tail preceded by a polyadenylation signal. L1, Alu and SVA elements are typically flanked by target site duplications (black arrows) that are generated upon integration. Elements are not drawn to scale. Because of transposition, a great deal of your DNA is repetitive…

Alu is very common… From page 258 of Genomes 3 by Terence A. Brown, 2006

Alu is a SINE Alu is a “Short Interspersed Nuclear Element.” These elements get “retrotransposed” from time to time in human history. Retrotransposition involves an RNA intermediate. Alu insertions are thought to be important in terms of evolution, but also in terms of genetic disease (0.4% of human genetic diseases). PV92 is not involved in a genetic disease.

The structure of an Alu element. (a) The top portion shows a genomic Alu element between two direct repeats formed at the site of insertion (red arrowheads). The Alu ends with a long A-run, often referred to as the A-tail, and it also has a smaller A- rich region (indicated by AA) separating the two halves of a diverged dimer structure. Alu elements have the internal components of a RNA polymerase III promoter (boxes A and B), but they do not encode a terminator for RNA polymerase III. They utilize whatever stretch of T nucleotides is found at various distances downstream of the Alu element to terminate transcription. A typical Alu transcript is shown below the genomic Alu, showing that it encompasses the entire Alu, including the A-tail, and has a 3' region that is unique for each locus. (b) The Alu RNA is thought to fold into separate structures for each monomer unit. The RNA has been shown to bind the 7SL RNA SRP9 and 14 heterodimer, as well as polyA-binding protein (PABP). It is thought that at least one other protein binds the duplex portion of the RNA structure. (c) In the target-primed reverse transcription mechanism, the Alu RNA (blue) brings the ORF2p to the genome where its endonuclease activity cleaves at a T-rich consensus sequence. The T-rich region primes reverse transcription by ORF2p on the 3' A-tail region of the Alu element. This creates a cDNA copy of the body of the Alu element. A nick occurs by an unknown mechanism on the second strand and second-strand synthesis is primed. The new Alu element is then flanked by short direct repeats that are duplicates of the DNA sequence between the first and second nicks. Genome Biol. 2011; 12(12): 236. Published online 2011 December 28. doi: /gb PMCID: PMC Alu elements: know the SINEs Prescott Deininger1

Why so few Alu elements are active: Out of the more than 1 million Alu elements in the human genome, very few are capable of making copies, although many make transcripts. Upon insertion in a new locus, the factors that make a very active Alu element are the flanking sequences influencing the promoter, creating a short unique region. Active elements match the consensus Alu element fairly closely and they have a long and fairly perfect A- tail. Active elements degrade rapidly on an evolutionary time scale by A-tail shortening, heterogeneous base interruptions accumulating in the A-tail, and eventually by the accumulation of random mutations in the Alu element. At least some of these changes alter Alu activity through disruption of the various proteins binding to the RNA in the ribonucleoprotein (See previous image). It is thought that a LINE called L1 can provide the functions Alu needs for retrotransposition. Genome Biol. 2011; 12(12): 236. Published online 2011 December 28. doi: /gb PMCID: PMC Alu elements: know the SINEs Prescott Deininger1

The PV92 “genetic system” involves an Alu insertion event that has no medical or other ramifications.

PCR Here are the primers we used to copy the stretch of your DNA that lies between them (in our case 600 or 900 bp). Left Primer (aka forward) 5'-AACTGGGAAAATTTGAAGAGAAAGT-3' Right Primer (aka reverse) 5'-ATGGATGTAGTTGGTGTCATGGTCA-3' reverse complement TGACCATGACACCAACTACATCCAT

DNA is Anti-Parallel From Genomes 3 by Terence A. Brown, 2006

Primer Notation Left, Forward, Upstream… 5’-AACTGGGAAAATTTGAAGAGAAAGT-3’ Right, Reverse, Downstream… 5’-ATGGATGTAGTTGGTGTCATGGTCA-3’

The Polymerase Reaction

Paper PCR in Class Activity Match these primers to the double-stranded DNA on your desk. Fill in the worksheet. Remember 5’  3’ convention