Avian Influenza H5N1: Vaccination Against a Pandemic

HPAI H5N1 Epidemic in Poultry Populations in Asia

Vaccination Against a Potential Pandemic  The WHO issued a influenza pandemic preparedness plan in 1999  One initiative of the plan is to rapidly prepare a vaccine against H5N1  One commercial vaccine-producing institution and several research institutions are currently on the case  K. Subbarao et al. and M. Liu et al. have used a process of plasmid based reverse genetics to create an experimentally working H5N1 vaccine

What Is H5N1?  Influenza A from the family of Orthomyxoviridae  Negative single-strand RNA virus with segment genome  Haemagglutiinin and Neuraminidase viral proteins  15 subtypes of haemagglutinin and 9 subtypes of neuraminidase  All subtypes exist in wild aquatic birds

H5N1 Statistics  Wild aquatic birds are a natural reservoir for all influenza A viruses  Hong Kong 1997 outbreak of H5N1 AI in poultry resulted in the first human cases: 18 infected, 6 die  In 2003 a new subtype of H5N1 AI infected humans  WHO reports that since January 28, 2004, 44 infected resulting in 32 deaths  New subtypes produce a morbidity rate of 70% in humans compared to 33% of the initial H5N1

Nomenclature  AI : Avian Influenza  HP: High Pathogenic  LP: Low Pathogenic  HA: Haemagglutinin  NA: Neuraminidase A/goose/Guangdong/1/1997 (H5N1) Antigenic Type Infected animal Geographic site of isolation Year of isolation Antigenic description Influenza A H5N1 strain #1 isolated from a goose in Guangdong during 1997 Strain #

Increasing Virulence of H5N1  Antigenic drift resulting from point mutations in the HA and NA genes  Alterations in the surface protein (HA) results in the loss of antibody to neutralize new virus Query: 541 aataataccaaccaagaagatcttttggtactnnnnnnnattcaccatcctaatgatgcg 600 |||||||||||||||||||||||||||||||| ||||||||||||||||||||| Subjct:569 aataataccaaccaagaagatcttttggtactgtgggggattcaccatcctaatgatgcg 628 Query: 601 gcagagcagacaaagctctatcaaaacccaaccacctatatttccgttgggacatcaaca 660 ||||||||||||| ||||||||||||||||||||| |||||||||||||| ||||||||| Subjct:629 gcagagcagacaaggctctatcaaaacccaaccacttatatttccgttggaacatcaaca 688 BLAST nucleotide alignment of two haemagglutinin genes from A/chicken/Hubei/489/2004(H5N1) and A/chicken/Thailand/CH-2/2004(H5N1 )

Subbarao 2004

Haemagglutinin  HA is to binds to the host cell by sialic acid receptors containing either alpha 2,6-galactose linkages (human) or alpha 2,3-galactose linkages (avian)  Binding of alpha 2,6-galatose linkages corresponds to human epithelial cells and alpha 2,3-galactose linkages corresponds to avian intestinal epithelial cells  Possible reason why H5N1 is not able to cause human-to-human transmission is that haemagglutinin of avian origin has not acquired human receptor-binding specificity.  Once haemagglutinin binds it elicits a neutralizing antibody response

Determining Pathogenicty  Pathogenicity determined by cleavage of the haemagglutinin into two subunits  Low pathogenicity caused by proteases in mammalian respiratory tract/ avian intestinal tract cleaving the haemagglutinin  High pathogenicity determined by proteases present in a multitude of tissues to cleaving haemagglutinin  Highly pathogenic H5 has multiple basic amino acid in connecting peptide of the HA gene, which is adjacent to the cleavage site  Current vaccine research for HPAI H5N1 targeted to the multiple amino acid motif  Subbarao et al. and Liu et al. two groups of researchers that have created an inactivated H5 HA by eliminating the multiple amino acids.

Copyright ©2002 by the National Academy of Sciences Guan, Y. et al. (2002) Proc. Natl. Acad. Sci. USA 99, Fig. 1. Phylogenetic trees for the H5 HA1 (a), NP (b), and NS (c) genes of influenza A viruses

Vaccination Production By Reverse Genetics  Reverse genetics: method of genetically engineering portions of the genome and observing the resulting phenotype  Benefits of using reverse genetics: 1. creating a safer virus to work with 2. decreasing embryonated egg mortality 3. higher growth yields/ faster to produce  Can inactivate H5 HA gene by modifying the multiple basic amino acids adjacent to cleavage site associated with HPAI

Experiments: Subbarao et al.  Targeted H5 Ha gene of wt HK/491/1997: GAG AGA AGA AGA AAA AAG AGA GGA TTA TTT Arg Arg Arg Arg Lys Lys Arg Gly Leu Phe Modified: ACT CGA GGA TTA TTT Thr Arg Gly Leu Phe Removed basic amino acid motif by RRT-PCR Isolates and rescues PR8 gene from A/Puerto Rico/8/34 (PR8) (H1N1) Transfected 293t cells with plasmid containing isolated genes Reassortant phenotype: H5N1/PR8

Experiments: Subbarao et al.  Reassorted virus passed in 9-10 day old embryonated eggs  Grown in the allantoic cavity to high infectivity titers  No plaques on MDBK cells in absence of trypsin  Tested virus on chickens resulting in no deaths, no shedding and 50% with detectable antibodies  Tested on BALB/C mice, no deaths, but low detectable shedding in lungs  Removal of basic amino acid motif resulted in loss of virulence for H5N1

Experiments: Subbarao et al.  Produced a Formalin-inactivated H5N1/PR8 vaccine  Protected chickens and mice challenged with wt H5N1

Experiments: Liu et al.  Constructed efficacious H5N3 vaccine  Still protected against H5N1 except with the benefit of differentiating between the vaccinated and the infected by different NA  Similar deactivation of H5 HA region: A/goose/HK/437-3/99 (H5N1) GAG AGA AGA AGA AAA AAG AGA GGA TTA TTT Arg Arg Arg Arg Lys Lys Arg Gly Leu Phe Modified: ACA AGA GGA TTA TTT Thr Arg Gly Leu Phe

Experiments: Liu et al.  Also obtained PR8 from A/Puerto Rico/8/34 (PR8) (H1N1)  N3 taken from A/Duck/Germany/1215/73 (H2N3)  Same technique of reassortment  No embryo death and no plaque formations  No detectable replication in chickens  Low replication in mice including brain and lungs, but not after 7 days

Experiments: Liu et al.  Tested the efficacy of the H5N3 vaccines on chickens  Allantoic fluid of H5N3 vaccine in oil-emulsion adjuvant was efficacious against H5N1, concentration or purification not needed  Added benefit of discriminating between vaccinated and infected individuals

Discussion of Results  Results of the attenuated reassortant viruses and vaccine production indicate that use of reverse genetics have relevance to the prevention and control of H5N1 in poultry populations and potential human pandemic  Testing for a better animal model for humans has potentially been found  The benefits of using reverse genetic for vaccine process were demonstrated  Currently no human vaccine is available, but trials will start soon

Points to Ponder  Exclusive use of cell culture to generate and grow vaccine  Who/what target for vaccination  Other means of prevention: surveillance, stockpiling, communication  Intellectual property rights on reverse genetics technology

Finally…  There is a worldwide surveillance set-up and the US has been efforts to accrue prophylaxes drugs, especially neuraminidase inhibitors  Stricter hygiene guidelines have also been enforced in domesticated poultry farms  These efforts serve as a template for any new emerging infectious disease  Hopefully we will not see the projected statistics of a pandemic influenza due to early intervention