ST 660 Special Session on ICBL Margaret Waterman Southeast Missouri State University Ethel Stanley Beloit College Investigative Cases: Engaging Students.

Slides:



Advertisements
Similar presentations
Using Brain Research to Inform Instruction
Advertisements

The people Look for some people. Write it down. By the water
Word List A.
C E N T R A L P I E D M O N T C O M M U N I T Y C O L L E G E Pandemic and Influenza: A Guide to Understanding.
A.
Dolch Words.
SCOPE Workshop SDSC March , 2008 Margaret Waterman Southeast Missouri State University Ethel Stanley Beloit College Investigative Cases: Using Community.
Developing 21st Century Skills with Investigative Cases: Building Global Awareness Margaret Waterman, Ph.D. Biology Department Southeast Missouri State.
Joyfulness Vs. Self-pity
Open Educational Resources Margaret Waterman Faculty Development Day Jan. 12, 2012.
Plant IT: Careers, Cases, and Collaborations Getting Started with Investigative Cases July 7 th, 2008 Margaret Waterman Southeast Missouri State University.
Chapter 1 Jim Hawkins’ Story I
Engaging Students in Sustainability Issues: Investigative Cases, Tools and Data Margaret Waterman, Ph.D. Southeast Missouri State University IUBS Symposium,
The Flexibility of Case Methods Margaret Waterman Southeast Missouri State University 11 th Annual Conference on Case Study Teaching in Science September.
Using Investigative Case Based Learning May 30-June 9, 2006 BS 618 Dr. Margaret Waterman
PBL and Case Study Workshop Margaret Waterman Southeast Missouri State University Scarsdale High School Scarsdale, NY March 28, 2011.
The Flexibility of PBL Margaret A. Waterman, Ph.D. Southeast Missouri State University PBL 2006, PUCP, Lima Peru July 20, 2006.
New York State Department of Health, Bureau of Immunization, August 2012.
Pandemic influenza planning tool kit for business/employers, dev'd spring PREPARING FOR AN INFLUENZA PANDEMIC.
Preparing Small Business Workplaces for Pandemic Flu.
Join us in Summer 2008! Plant IT : Careers, Cases, and Collaborations Ethel Stanley BioQUEST Curriculum Consortium Claire Hemingway Botanical Society of.
“Hi Bizby! Why the sad face?” asked Rosy. “We just got back from a world that has run out of natural resources. It was awful,” replied Bizby. “How could.
Science Case Network How an RCN-UBE on Case Studies and PBL Can Help Address Vision & Change in Microbiology Education Margaret Waterman, Ethel Stanley,
Introduction to Project BudBurst Mr. Hefti – Pulaski High School CSA 503 Spring 2014.
Chautauqua Short Course August 6-8, 2007 Grand Valley State University Grand Rapids, Michigan Ethel Stanley Beloit College Margaret Waterman Southeast.
Session 2 Teaching Comprehension Strategies with Explicit Instruction.
Module 1: Unit 1, Lesson 3 Inferring about character: Analyzing and discussing points of view (Chapter 2)
Emerging Diseases – Ready and Waiting Aileen J Plant Curtin University of Technology 19 October, 2004 Emerging Diseases: the human health perspective.
Association of Health Care Journalists Preparing Communities For Pandemics Houston, Texas March 18, 2006 Georges C. Benjamin, MD, FACP Executive Director.
The Flexibility of Case Methods Margaret Waterman Southeast Missouri State University 11 th Annual Conference on Case Study Teaching in Science September.
Welcome to our time together ! We will get started at the top of the hour Welcome to our time together ! We will get started at the top of the hour Please.
Created by Verna C. Rentsch and Joyce Cooling Nelson School
What Would it Look Like to The Power of Digital Media to Improve Application Time and Student Achievement FLIP YOUR CLASSROOM? Katy Clay – Grosse Pointe.
Why did the young man name his puppies Biology, Chemistry and Physics?
Diseases and the Immune/Lymphatic System. 5g 5g.
DO NOW Journal Entry – answer the following: Journal Entry – answer the following: What is environmental science?
I am ready to test!________ I am ready to test!________
Sight Words.
Winona H1N1 Control Plan Matt Dillon Patrick Keys Karsten Jepsen Allie Lyman.
What’s up with the flu? Novel H1N1? SWINE FLU??? Mexican flu? swine-origin influenza A? A(H1N1)? S-OIV? North American flu? California flu? Schweingrippe.
Pandemic Influenza American Red Cross. The American Red Cross is where people mobilize to help their neighbors—across the street, across the country and.
Scott Foresman Reading Street Word Wall Word List First Grade Kindergarten & Supplement Words Included.
Science Case Network How an RCN-UBE on Case Studies and PBL Can Help Address Vision & Change in Microbiology Education Margaret Waterman, Ethel Stanley,
The Prodigal Son Year 5 Here I Am Lesson 4. The Prodigal Son Introduction Jesus told many stories to his friends to help them understand difficult things.
Investigative Cases BioQUEST Summer Workshop 2005 Joyce Cadwallader Robin Greenler Stacey Kiser Ethel Stanley >NY-99flamingo CCAACTACTGTGGAGTCGCACGGAAACTACTCCACACAGGTTGGAGCCACTCAGGCAGGGAGATTCAGCATCACTC.
National Institutes of Health Emerging and Re-emerging Infectious Diseases Part 4.
What is a paragraph? A paragraph is a group of sentences related to a particular topic, or central theme. Every paragraph has a key concept or main idea.
High Frequency Words August 31 - September 4 around be five help next
Red the Tomato A Trip from Farm to Table Sean Edward Wilson Rensselaer Polytechnic Institute 15’ Sustainability Education Fall 2015.
Peer Pressure / Refusal Skills. Health Class Reminders Take out your Peer Pressure and Refusal Skills notes from last Friday. Take the first 10 minutes.
Sight Words.
A Home for Diggory Contents 1.No Home for Diggory 2.The File Star 3.Little Miss Spoiled 4.The Runner 5.Big Mac.
High Frequency Words.
Section 21.4 Emerging Infectious Diseases Slide 1 of 15 Objectives Define the term emerging disease. Identify five reasons why diseases emerge. Section.
Integration of Bioinformatics into Inquiry Based Learning by Kathleen Gabric.
An Interview Dialogue Name: Period:. Step Five Interview- An Interview Dialogue You are going to read the question and pick the best response. The person.
Angela sighed as she held a copy of Derrick’s Malaise. “I’m supposed to come up with my own problems for study in this bio course?” she asked no one in.
Module 6 Problems Unit 2 If you tell him the truth now, you will show that you are honest. ask for advice give advice.
Differentiating Reading Instruction. What does it mean to differentiate?
Using Cases to Teach Biology UW-Madison October 18, 2012 Ethel Stanley, BioQUEST Science Case Network >Texas ATGAATCCAAACCAAAAGATAATAACCATTGGTTCGGTCTGTATGACAATTGGAATGGCTAACTTAATAT.
How can we improve the health care experience of our community?
It was the first day of school. Mother made a special breakfast.
Created By Sherri Desseau Click to begin TACOMA SCREENING INSTRUMENT FIRST GRADE.
ESSENTIAL WORDS.
ECC Portfolios: Using Project Based Learning to Teach the ECC
The Flexibility of Case Methods Margaret Waterman Southeast Missouri State University 11th Annual Conference on Case Study Teaching in Science.
Fry Word Test First 300 words in 25 word groups
The of and to in is you that it he for was.
Susceptible, Infected, Recovered: the SIR Model of an Epidemic
Presentation transcript:

ST 660 Special Session on ICBL Margaret Waterman Southeast Missouri State University Ethel Stanley Beloit College Investigative Cases: Engaging Students in Scientific Problem Solving YearMaleFemale

"I read on the Internet that you can get Mad Cow Disease from Altoids." The Rumor

"Well, they are made in Great Britain and they do have gelatin in them.”

What do you think this case is about? What do you already know that relates to this case? What do you need to know to understand the case? How do think this case could be used?

Challenges for Science Instruction: NSF 1.Include inquiry so students understand the process of science. 2.Relate science to what students already know. 3.Put science in social and technological perspective. 4.Encourage collaboration and student responsibility for learning.

Cases are one tool to answer these challenges

Case Methods: Elements in Common All use realistically complex problems All are multidisciplinary All ask learners to consider the events, decisions, facts

Case Methods provide learners with an opportunity to: Engage with characters and circumstances. Investigate to understand facts, values, contexts, and decisions. Connect the meaning of the story to their own lives

Some Core Features of PBL /ICBL Problems are real and meaningful contexts for learners. PBL cases are complex and multidisciplinary. The problem comes first. Learners collaborate and identify what they need to learn. Learners identify and use resources. Problems require decision making, use of concepts and skills.

Investigative Case Based Learning ICBL blends two established methods: cases and scientific inquiry  The cases provide a context for learning.  Students engage in investigations related to the case. This includes lab, field, and computer activities. Instruction is organized around the BioQUEST 3Ps.

The BioQUEST 3Ps The BioQUEST philosophy is based on the activities of practicing scientists. Problem posing Problem solving Peer persuasion

Key Questions for Planning to Teach with a Case What is something related to the case that students could investigate? What resource might be useful in a student investigation ? What kinds of products could students produce related to this case? What learning objectives can be addressed?

Meet Diverse Objectives by varying PBL implementation: To assess knowledge and skills To initiate investigations To introduce new technologies To develop global and multicultural perspectives To see value of interdisciplinarity

"I read on the Internet that you can get Mad Cow Disease from breath mints.” The Rumor Using PBL: Pre- Assessment

Using PBL: Assessment Resources for each student: prepared slide of suspect plant material list of back yard plants by gardener The following take home exam was based on a mini case in which a 14 week-old puppy that “chews on everything” was found ill in the back yard.

Using PBL: Assessment Submit a memo reporting your findings as a forensics specialist: Provide an identification of the plant material with evidence to support choices: root, stem, or leaf dicot or monocot herbaceous or woody

Using PBL: Assessment : Write a short letter to the pet owner advising the family to remove the poisonous plant from their back yard: Provide a description of the plant as it would look during flowering and be sure to include: common and scientific name habitat preference danger to humans

To assess knowledge and skills To initiate investigations To introduce new technologies To develop global and multicultural perspectives To see value of interdisciplinarity Meet Diverse Objectives by varying PBL Implementation:

New York 99 Ben called his old friend Lynn after hearing the latest count of people sick with West Nile Virus. "Hey Lynn, you work in environmental health. What can you tell me about this West Nile Virus? We have a real epidemic going on here in Texas and everyone is saying it came from your state." Lynn groaned "I am so sick of New York being blamed! West Nile Virus has been around a lot longer, and it is called West Nile for a reason,” she huffed. “It is true that the first U.S. virus was detected in 1999 in a dead flamingo and a sick horse in New York City. But now it's all over the US. " "It sure is - but, wait - a bird and a horse? I don't get it." Using PBL: Investigations and Technologies

End of 2003

Clinical course of West Nile encephalitis Solomon, T., Brit. Med. J. 326, (2003)

“It’s called West Nile for a reason...” Data set from

The Biology WorkBench is a web-based resource for analyzing and visualizing molecular data developed at NCSA (the National Center for Supercomputing Applications). Database searching is integrated with access to a wide variety of analysis and modeling tools

Aligned Sequences of WNV E Gene

Approximate global distribution of West Nile virus Solomon, T., Brit. Med. J. 326, (2003)

Using Cases: Lab Technology FILTHY LUCRE: A Case Study Involving the Chemical Detection of Cocaine-Contaminated Currency Ed Acheson Department of Chemistry Millikin University, Decatur, IL

Using Cases: Lab Technology Tom Brown [was daydreaming while standing in the security line at the airport.] He was in a particularly good mood because Grandma Brown had given him $200 in cash as a Christmas present... Tom had tucked the cash into his carry-on. "Sir?” repeated a loud voice. “We have detected evidence of illegal drugs and will need to search your carry-on.”

Using Cases: Lab Technology Tom’s cash ($200 in ones) will be treated with methanol to extract any cocaine present in the money. The extract will then be injected into the gas chromatograph / mass spectrometer (GC/MS), which will determine if any cocaine is present.

Using Cases: Lab Technology Roll the bill and place it into a clean vial. Add 2 mL of methanol to the vial. Cap the vial and shake for 1 minute. Using a glass Pasteur pipette, transfer enough methanol to an autosampler vial to fill the vial about three-quarters full. Remove the bill from the vial when you are finished using a forceps.

Meet Diverse Objectives by varying PBL Implementation: To assess knowledge and skills To initiate investigations To introduce new technologies To develop global and multicultural perspectives To value interdisciplinarity

In the 1840’s, Late Blight devastated the potato crop which resulted in mass starvation and forced migration of the human population. Using PBL: Multicultural & Interdisciplinary

Using PBL: Simulating Late Blight Free software available at the link below. Click on “Modules” and then on “Lateblight”

Sporangia from cull pile Infections from volunteers Crop defoliated and entirely lost well before harvest Simulation Results: IRELAND 1840’s Cool, wet conditions, no pest management % blight sporangia infections

Modern Management: Blight Cast Using 1840 conditions. Result of spraying every 5 days = $278 profit, no tuber loss, 3% foliage loss. sprays sporangia

Meet Diverse Objectives by varying PBL Implementation: To assess knowledge and skills To initiate investigations To introduce new technologies To develop global and multicultural perspectives To value interdisciplinarity

Footprints “I’m glad I don’t live on a 200 acre farm like you, Sam!” teased Sue as the two friends hurried into their Biology class. “Why?” asked Sam, “Weren’t you just complaining about living in your parent’s downtown condo?” “Well, that’s true,” Sue admitted, “But I was thinking about today’s class assignment on sustainability. I bet you have the biggest footprint in the whole class.” Much to Sue’s surprise, Sam didn’t look all that concerned. He held out his hand and replied confidently, “I’ll take that bet!”

What is this case about? What do you already know? What do you need to know?

Online Tools: a global resource used locally

Questions from Footprint Quiz Food: amount of meat, how much food is local Goods: how much waste is produced Shelter: size of home, number of people, availability of water and electricity Mobility: kinds of transportation, car pooling, air time, fuel efficiency

The Results Sue Sam

Go to Footprint quiz and find out your ecological footprint

What could you teach with this? What kinds of resources might be useful?

World Resources Institute, 2005, Navigating the Numbers, pp. 4,5 Global Data and Visual Resource

Global Data Resource: One Policy for All? Navigating the Numbers: Greenhouse Gas Data and International Climate Policy

Sources of GHG by Level of Economic Development Navigating the Numbers: Greenhouse Gas Data and International Climate Policy Global Data Resource: One Policy for All?

Interactive Data Source

Visual Data NOAA Carbon Tracker

T. BARTLEY:.. you ain't old enough to remember the year the flu struck the people so bad in this... in this country, do you? HAWKINS: Yeah, I think that both my… both my great-grandparents died in that. T. BARTLEY: It was the saddest lookin‘ time then that ever you saw in your life. My brother lived over there in the camps then and I was working over there and I was dropping cars onto the tipple. And that, that epidemic broke out and people went to dyin’ and there just four and five dyin‘ every night dyin’ right there in the camps, every night. And I began goin‘ over there, my brother and all his family took down with it, what’d they call it, the flu? Yeah, 1918 flu. And, uh, when I’d get over there I’d ride my horse and, and go over there in the evening and I’d stay with my brother about three hours and do what I could to help ’em. And every one of them was in the bed and sometimes Doctor Preston would come while I was there, he was the doctor. And he said “I’m a tryin‘ to save their lives but I’m afraid I’m not going to.”And they were so bad off. And, and every, nearly every porch, every porch that I’d look at had—would have a casket box a sittin’ on it. And men a diggin‘ graves just as hard as they could and the mines had to shut down there wasn’t a nary a man, there wasn’t a, there wasn’t a mine arunnin’ a lump of coal or runnin' no work. Stayed that away for about six weeks.. “There Wasn’t a Mine Runnin’ a Lump O’ Coal”: A Kentucky Coal Miner Remembers the Influenza Pandemic of 1918–1919

1.What is this case about? Flu of 1918 and its effects on coal mining, community KnowWish to Know There was a pandemic of flu in It killed many people. It interrupted work, mines closed. Some people lived in camps. It lasted about 6 weeks, according to the transcript. The doctor felt he couldn’t help people get better. Dealing with the dead was a huge issue. In 1918, World War I was ending. There were no vaccines then. Viruses were unknown. Influenza is caused by a virus. There’s a flu shot that you get every year. Did soldiers/sailors bring the flu from elsewhere? Was there flu in other countries besides the US? How long did it last? What treatments were available then? What treatments were available now? How is flu spread? Why did so many people die of it? What made this particular flu so deadly? Do people die of flu today, like the annual flu? Have there been other epidemics of flu? Could it happen again?

Currently, 16 antigenically distinct groups of H molecules and 9 distinct groups of N molecules have been identified. The immune system responds specifically to each of the H and N surface proteins found in a virus particle. How many possible combinations of H and N could occur? Human glycoprotein receptors (eyes, nose, upper throat) for H1, H2 and H3 influenza A facilitate transmission of these strains among humans. How many of the total influenza A combinations above would you expect to be easily transmissible to humans? Content, directive

Interactive Maps /bird_flu_map/html/1.stm /bird_flu_map/html/1.stm m/ET/ m/ET/

Data

YearMaleFemale Average Age at Death from 1911 until 1919 (Noymer 2007) Making Inferences

Age < US Deaths per 100,000 Attributed to Influenza and Pneumonia in 1917 and 1918 (Noymer 2007) Making Inferences, extended

Street car conductor in Seattle not allowing passengers aboard without a mask. Record held at: National Archives at College Park, MD. 165-WW-269B-11National Archives at College Park, MD. In 1918, Seattle public health officials required all passengers and employees mass transit systems wear masks. At that time no one knew what caused the influenza and vaccines were not available. It was understood that coughing and sneezing contributed to the spread of the disease. Spitting was also prohibited in many cities. Mitigation Strategies

Predict generally what changes you’d expect to see in the SIR model results with respect to S, I, and R individuals if you were to simulate the use of masks. (Hint: Assume a 10% decrease in transmission.) Tools

Resources from Biological ESTEEM: Excel Simulations and Tools for Exploratory, Experiential Mathematics

Modeling, scaffolded Pharmacological Interventions Vaccination Antivirals as prophylactics Nonpharmacologic interventions (NPIs) – efficacy and gaining compliance Community mitigation (school closures, restrictions on movements) Quarantine and isolation of healthy and sick individuals Travel restrictions locally and globally Social distancing Use of masks and increased hygiene

Simulation Results for Scenario 2 of Avian Influenza with 250 people (200 susceptible) and the use of masks with a 10% reduction in transmission. Masks are used starting on day 30, when the epidemic has already nearly run its course.

What would happen if masks were used starting on day 10? How about on day 0? Go to Click on “Unit 9”, then on “SIR model”

How would cases work in your teaching?

Warning! Case in Use

Angela sighed as she held a copy of Derrick’s Malaise. “I’m supposed to come up with my own problems for study in this bio course?” she asked no one in particular. She re-read the short case.

“What caused Derrick’s malaria?” Angela thought. The only thing Angela knew about malaria was that people got it when they lived in other countries.

Angela noticed other students going to the computers or leafing through books at the front of the room. She decided to go to a computer herself. Using Google, she looked up malaria and found the Mosquito Bytes site.

When the teacher walked by, he saw this on Angela’s screen.

Do you think Angela is a good student? How could we help her?