טרנסקריפציה השלב הראשון בתהליך התבטאות הגנים = סינתזת מולקולת RNA

What is a (protein-coding) gene? Protein mRNA DNA transcription translation CCTGAGCCAACTATTGATGAA PEPTIDEPEPTIDE CCUGAGCCAACUAUUGAUGAA

The pathway of gene expression Protein mRNA DNA transcription translation CCTGAGCCAACTATTGATGAA PEPTIDEPEPTIDE CCUGAGCCAACUAUUGAUGAA

Some nomenclature conventions RNAP

RNADNA

RNA Similarities and Differences Between DNA and RNA Similar strand structure Can define a 5’ and 3’ end 2’ hydroxyl in RNA: causes stability differences) Uracil in RNA takes the place of Thymine in in DNA

CCA adding enzyme RNase P מולקולת ה-RNA עוברת מבנה שניוני.

tRNA

מבנה שניוני של RNA Stem & loop

ההבדלים בין RNA ל DNA קבוצת OH בעמדה 2 של הריבוז (RNA) לעומת קבוצת H באותה עמדה ב- DNA. קבוצת ה-OH משפיעה על יציבות הקשר הפוספודיאסטרי (קשר הפוספאט). U מחליף T. בסיסים שעוברים מודיפיקציה גדיל ה-RNA יוצר מבנה שיניוני בניגוד ל DNA היוצר מבנה דו-גדילי בין שתי גדילי DNA - המבנה השיניוני של מולקולת ה RNA קובע את פעילות ה RNA.

Promoters Transcription starts at promoters on the DNA template RNA polymerase binds tightly to such promoters Sequence of this DNA is represented by the sense strand and has the same sequence and directionality as the transcribed RNA Two common sequences are present upstream (on the 5 ’ side) of the start site Rates at which E. coli genes are transcribed depend upon the stability of the initiation complex between the promotor and RNA polymerase

RNA polymerase

PromotersPromoters - DNA sequences that guide RNAP to the beginning of a gene (transcription initiation site). - DNA sequences that guide RNAP to the beginning of a gene (transcription initiation site). TerminatorsTerminators - DNA sequences that specify then termination of RNA synthesis and release of RNAP from the DNA. - DNA sequences that specify then termination of RNA synthesis and release of RNAP from the DNA. RNA Polymerase (RNAP)RNA Polymerase (RNAP) - Enzyme for synthesis of RNA. - Enzyme for synthesis of RNA. Reaction (ordered series of steps)Reaction (ordered series of steps) 1) Initiation. 1) Initiation. 2) Elongation. 2) Elongation. 3) Termination. 3) Termination. Bacterial (Prokaryotic) Transcription רצף המכוון את רנא פולימראז תחילת הגן רצף הגורם לרנא פולימראז להפסיק את תרגום הגן

Other important nomenclature conventions 5’ 3’ Template strand +1 Transcription Initiation Site Direction of transcription “Downstream”“Upstream” There is no “zero”

-10 region RNAP binds a region of DNA from -40 to +20 The sequence of the non-template strand is shown TTGACA…16-19 bp... TATAAT “-35” spacer “-10” Promoter sequences לאורך ה"ספיסר" יש משמעות – ארוך או קצר יוצר פרומוטר חלש

E. coli promoter sequences for 13 genes Promoter sequences for mRNAs. RNA polymerase seeks out the consensus sequences for proper orientation for binding to initiate transcription. Note promoter sites have regions of similar sequences at the -35 region and -10 region. Minus numbers represent bases upstream of mRNA start point, +1 is the first base in the RNA transcript. TR5

RNA polymerase II

Structure of E. coli RNA Polymerase Five core subunits  2  ’ω Sixth subunit (  ) binds core transiently and directs enzyme to specific DNA binding sites Has overall “hand” shape –Similar in structure to DNA polymerase –During chain elongation, thumb closes over DNA- binding channel

שלבי הטרנסקריפציה Initiation Elongation Termination

פקטור סיגמא

Sigma factor

Finding and binding the promoter Closed complex formation RNAP bound -40 to +20 Open complex formation RNAP unwinds from - 10 to +2 Binding of 1st NTP Requires high purine [NTP] Addition of next NTPs Requires lower purine [NTPs] Dissociation of sigma After RNA chain is 6-10 NTPs long initiation

  (sigma subunit) allows RNA polymerase to recognize and bind specifically to promoter regions. E. coli RNA polymerase +  subunit TR6

initiation

elongation

Chain Elongation RNA synthesis proceeds 5 ’ 3 ’ Double-stranded DNA is open at the point of RNA synthesis Transcription “ bubble ” moves with RNA polymerase DNA becomes more tightly wound (positively supercoiled) ahead of the transcription bubble and unwound (negatively supercoiled) behind the bubble

Sense and Antisense DNA Initiation of RNA synthesis occurs at specific sites on DNA DNA strand that serves as the template during transcription is the antisense (noncoding) strand Sense (coding) strand of DNA has the same sequence as the transcribed RNA, except for replacement of U with T

RNA polymerase elongation ה"עין" כ-12 זיווגי בסיסים

Elongation

mRNA Transcription TR7 רנא פולימראז מכניס שגיאה אחת ל נוקלאוטידים, אין לו מערכת לתיקון שגיאות טופואיזומראז לפני ואחרי רנא פולימראז

The theory of the template 2 - better Base pairing explained DNA replication. But no obvious structural complementarity between bases of DNA and amino acids of proteins

Subsequent hydrolysis of PPi drives the reaction forward RNA strand OH DNA strand RNA Synthesis is in the 5 ’ to 3 ’ Direction RNA has polarity (5’ phosphate, 3’ hydroxyl)

NTPs

Rho-Dependent Transcription Termination (depends on a protein AND a DNA sequence) G/C -rich site RNAP slows down Rho helicase catches up Elongating complex is disrupted

Rho-Independent Transcription Termination (depends on DNA sequence - NOT a protein factor) Stem-loop structure

Rho-independent transcription termination RNAP pauses when it reaches a termination site. The pause may give the hairpin structure time to fold The fold disrupts important interactions between the RNAP and its RNA product The U-rich RNA can dissociate from the template The complex is now disrupted and elongation is terminated

Rho-Independent Termination of Prokaryotic Transcription RNA transcript has self-complementary sequences permitting the formation of a hairpin structure Short string of adenylate residues in the template are transcribed into uridylates at the 3 ’ end Formation of hairpin disrupts interactions between RNA and RNA polymerase

Rho-Dependent Termination Rho factor (  ) is an ATP-dependent helicase that catalyzes the unwinding of RNA:DNA hybrid duplexes Recognizes C-rich regions in single-stranded RNA Advances in the 5 ’ 3 ’ direction until it reaches the transcription bubble with a paused RNA polymerase Unwinds the RNA-DNA duplex, releasing the RNA transcript Rho factor From Garrett & Grisham, Biochemistry (2 nd edition) Saunders, Fort Worth (1999)

termination סיום טרנסקריפציה

RNA polymerase

termination

Xmas tree – transcription

Xmas tree – transcription

Genes and Operons Genes are DNA sequences that encode polypeptides, rRNA, and tRNA, as well as sequences that have a role in initiating and ending transcription Most eukaryotic protein-coding genes are individually transcribed Many prokaryotic genes exist as operons and are transcribed together

Prokaryotic genes פוליציסטרוני – יחודי לפרוקריוטיים בלבד. באוקריוטים mRNA אחד יוצר סוג אחד של חלבון

Prokaryotic termination

מדוע צריך לבקר את אופן התבטאות הגנים בחיידקים? הסביבה בה החיידק נמצא משתנה. היכולת של החיידק לשרוד בסביבה המשתנה מותנת ביכולתו להתאים את עצמו. על החיידק לבטא את הגנים שלו על מנת לשרוד. אבל להפעלת הגנים ליצור מולקולות רנא וחלבונים יש מחיר אנרגטי יקר. לכן צריך להפעיל את הגנים כאשר זקוקים לתוצרים שלהם. חלבונים (והגנים שלהם) המבוטאים כל הזמן נקראים "housekeeping", בעוד שחלבונים המבוטאים כתלות בסביבה נקראים "inducible".

Alternate sigma factor usage: controls selective transcription of entire sets of genes s 32 s 60 vegetative (principal s) heat shock nitrogen starvation s 70 TTGACATATAAT (16-19 bp) (5-9 bp) A +1 CNCTTGACCCATNT (13-15 bp) (5-9 bp) A +1 CTGGNA TTGCA (6 bp) (5-9 bp) A +1 Ways to Regulate Transcription

Lac operon Lac II אופרון – קבוצת גנים המקודדים לחלבונים מאותו מעגל מטבולי ומאורגנים בקבוצה המבוטאת יחד.

טרנסקריפציה

The pathway of gene expression

Pre-mRNA

5’UTR 3’UTR

בתאי כבד בעכבר

Eukaryotic Promoters More complex and diverse than prokaryotic promoters RNA polymerase I promoters –Multiple copies of rRNA genes exist –RNA polymerase I recognizes only one species-specific promoter –Requires a core promoter element and an upstream promoter element RNA polymerase III promoters have variable locations relative to the transcribed gene More attention has been paid to RNA polymerase II promoters because they are involved in the transcription of mRNA

יעילות ותדירות מיקום +1 רמה נמוכה (בזלית) E S RE אינטרונים