A 1 A 2 A 1 A 3 Parents Offspring Genetic Drift: Extreme Example Some possible outcomes A 2 A 1 A 1 A 3 all alleles survive A 1 A 1 A 2 A 1 A 3 lost A 1 A 3 A 1 A 3 A 2 lost A 2 A 3 A 2 A 3 A 1 lost A 1 A 1 A 1 A 1 A 2 and A 3 lost

When is genetic drift important? n When populations undergo dramatic declines (bottleneck effect) Cheetahs Whooping Cranes (down to 13 individuals at one time) Pere David’s Deer Northern Elephant Seal n When a small number of individuals establish a new population (founder effect)

Drift: Bottleneck Effect A1A1 A2A2 A3A3 A4A4 A5A5 A6A6 A7A7 A8A8 A9A9 A 10 A 11 N = 10,000N = 2N = 10,000 A1A1 A5A5 A8A8 A9A9 11 alleles4 alleles ? When a population is reduced to a few individuals they cannot represent all of the alleles of the original population’s gene pool.

Bottleneck effect on Northern Elephant Seals --hunters reduced pop. to 20 in protection allowed pop. to recover to 30,000 **no variation at 24 allozyme loci **two mitochondrial DNA haplotypes as compared to 23 in Southern Elephant Seals **still at risk of extinction due to disease etc.

Drift: Founder Effect When a few individuals (or one seed, or one pregnant female) colonize a new habitat they cannot represent all of the alleles of the source population. ? A1A1 A2A2 A3A3 A4A4 A5A5 A6A6 A7A7 A8A8 A9A9 A 10 A 11 2 individuals start a new population 11 alleles at one locus Maximum of 4 alleles

One important effect of genetic drift is a decrease in heterozygosity n Cheetahs and other endangered species have little or no allelic diversity n Genetic drift has caused some alleles to disappear entirely

Two important features of genetic drift n The evolutionary change is random n Genetic drift is more pronounced in small populations

Migration n In population genetics, migration refers to gene flow - the movement of alleles rather than seasonal movement of animals n The result of migration is to equalize allelic frequencies among populations n Migration therefore can counteract genetic drift

Mutation n The only evolutionary mechanism that produces new alleles n Mutation therefore increases genetic diversity in a population n However, mutation does not occur quickly enough to be a useful tool for conservation biologists The highest mutation rates is about 1 in every 2,000 gametes That means, about 1 in 1000 offspring would carry the mutant allele On its own, mutation does little to change gene frequencies

Types of mutations n Point mutations Caused by failure of DNA polymerase to correct a mismatched base pair In some cases, mutations are inconsequential (silent mutations). Suppose a point mutation arises and the codon CTT mutates to CTC Both triplets code for the same amino acid (glutamic acid) In other cases, a point mutation can make a huge difference Human sickle cell anemia is caused by a single point mutation The triplet CTC mutates to CAC, coding for valine rather han glutamic acid

Sickle Cell Anemia n The substitution of a single valine for glutamic acid in the hemoglobin molecule causes the hemoglobin to crystallize when oxygen concentrations are low n The result is that the red blood cells become sickle-shaped instead of biconcave round cells n The sickled red blood cells have a difficult time passing through capillaries n The reduced blood flow causes anemia and intense pain

Types of mutations n Point mutations n Changes in nucleotide number in a gene Insertions of nucleotides - interrupt reading frame CTCAGGTCCTGCTAACCTA Insert a T after CTC CTCTAGGTCCTGCTAACCTA Almost always dysfunctional Deletions - interrupt reading frame; also almost always dysfunctional

Types of mutations n Point mutations n Changes in nucleotide number in a gene n Chromosomal mutations - usually occur during crossing over Deletion - removal of one or more genes Duplication - addition of second copy of one or more genes Inversion - reversal of order of one or more genes Translocation - movement of one or more genes to a non-homologous chromosome

Chromosomal mutations 1. Deletions 2. Duplications 3. Inversions 4. Translocations