Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Chapter 13 An Introduction to Cloning and Recombinant DNA
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Southern Blot Technique
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Southern Blot Technique Used to determine the structure of a gene or DNA sequence of interest May be used to analyze different alleles, related genes, and gene evolution
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Southern Blot Technique Steps –Isolate genomic DNA –Cut DNA with restriction enzymes –Separate DNA by size using electrophoresis –Transfer DNA to a membrane –Probe with sequence of interest that is radioactively labeled –Visualize with X-rays
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Fig The Southern Blot Technique
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Credit: © Inga Spence/Visuals Unlimited DNA Hybridization Blot on BioRad Gel Doc 1000 Imager.
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning + primer CATGT GTACACTTACGTACTCCTCAACGGATC DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC + DNA polymerase + A, C, T, G CATGT DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G GTACACTTACGTACTCCTCAACGGATC CATGTGAATGCATGAGGAGTTGCGTAG DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G + T DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA polynucleotide chain 5’ end O-O- O - -P = O O CH 2 Base O H 3 ’ H H H 5’ O-O- O - -P = O O CH 2 Base H 3 ’ H H H O 5’ OH 3’ end
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA polynucleotide chain 5’ end O-O- O - -P = O O CH 2 Base O H 3’3’ H 5’ 3’ end O-O- O - -P = O O CH 2 Base H 3’3’ H O 5’ H dideoxy base chain termination H H H H
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G + T GTACACTTACGTACTCCTCAACGGATC CATGTG DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G + T GTACACTTACGTACTCCTCAACGGATC CATGTGA DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G + T GTACACTTACGTACTCCTCAACGGATC CATGTGAA DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G + T GTACACTTACGTACTCCTCAACGGATC CATGTGAAT DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G + T GTACACTTACGTACTCCTCAACGGATC CATGTGAAT DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G + T GTACACTTACGTACTCCTCAACGGATC CATGTGAAT CATGTGAATGCAT DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G + T GTACACTTACGTACTCCTCAACGGATC CATGTGAAT CATGTGAATGCAT DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G + T GTACACTTACGTACTCCTCAACGGATC CATGTGAAT CATGTGAATGCAT CATGTGAATGCATGAGGAGT DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning T DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G + T GTACACTTACGTACTCCTCAACGGATC CATGTGAAT CATGTGAATGCAT CATGTGAATGCATGAGGAGT DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA pol + A, C, T, G + T + DNA pol + A, C, T, G + A + DNA pol + A, C, T, G + G + DNA pol + A, C, T, G + C DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning TAGC DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning TAGC G DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning TAGC G A DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning TAGC G A A DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning TAGC G A A T DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning TAGC G A A T G C A T G A DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGTGAATGCATGAGGAGTTGCCTAG DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning TAGC G A A T G C A T G A C T T A C G T A C T DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Improvements in Sanger Sequencing Four-color fluorescent dyes Use of scanners to read laser-induced fluorescence as products run off Improvements in sequencing reaction enzymes Replacement of slab gel electrophoresis with capillary gel electrophoresis
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA pol + A, C, T, G + T + DNA pol + A, C, T, G + A + DNA pol + A, C, T, G + G + DNA pol + A, C, T, G + C DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA pol + A, C, T, G + T + DNA pol + A, C, T, G + A + DNA pol + A, C, T, G + G + DNA pol + A, C, T, G + C DNA Sequencing
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing GTACACTTACGTACTCCTCAACGGATC CATGT + DNA pol + A, C, T, G
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Automated DNA Sequencing Fig
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Automated Sequencer
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Sequencing is just the start…
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Microarrays
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Goal: To get at complete expression profile in a cell/tissue at given time Step 1: Make or purchase microarray Need gene sequences and sequenced genomes PCR up real and predicted ORFs Spot on glass slide/chip DNA Microarrays
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Microarrays
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Isolate RNA from 2 different kinds of cells to be compared Cell 1 - RNA labeled with red fluorescent tag Cell 2 - RNA labeled with green fluorescent tag Step 2: Isolate and label RNA DNA Microarrays
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Step 3: Hybridize RNA to Microarray DNA Microarrays Hybridize chip with red and green RNA Use scanner to examine fluorescence Red - RNA present in Cell 1 but not Cell 2 Green - RNA present in Cell 2 but not in Cell 1 Yellow - RNA present in both
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Microarray Results
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Stem cells Saunders Magee Shriner-Cahn Chatterjee Lawrence Olson Prenatal genetic testing Brower Gorenkoff Kwak Cho Damiano Cheis Cloning of animals/humans Bondurant Lapides Simon Vigneron Prada Siegel Genetically modified plants/animals Powers Rosenblum Le Sotomil Coyle Kropp Too much technology? Spiwak Davidson Fei Grossman Marwell Roth Behavioral genes Seplowitz Rich Lenard Collins Dionne Rudberg