Genetic exchange in bacteria/archaea OEB 192 – 09.09.16.

Slides:

Advertisements

Similar presentations

OEB 100 – Evolution in Action (OEB 100) Instructor: Christopher Marx Teaching fellow: Dipti Nayak Weekly meeting: NW B127 Time: Mondays 4 – 5:30.

Advertisements

SCHOOL OF BIOLOGICAL SCIENCES Royal Holloway University of London SCHOOL SEMINARS

 Learning Essential Question:  What is immunity?  What is an immune response?  Vocabulary: Specific immunity Specific immunity Non-specific immunity.

Biology of Microorganisms 11th edition ISBN

OEB 192 – Tradeoffs, specialization & pleiotropy.

BIOS E-127– Evolution of pathogens (Grenfell et al., 2004)

BIOS E-127 – Evolution of digital organisms.

OEB 192 – Physiological basis of adaptation.

Detecting HGT: unlikely presence/absence HGT onlyLoss only (Koonin, 2003) Ex: glycerol-3-P DH OEB 192 –

Miki Lee / OEB 192 – Mobile genetic elements and adaptive mutation.

OEB 192 – Tradeoffs, specialization & pleiotropy.

OEB 192 – Evolution of pathogens (Grenfell et al., 2004)

An example story OEB (Nature 394:69-72)

OEB 192 – Mobile genetic elements and adaptive mutation.

OEB 192 – Mutation rate & population size II.

OEB 192 – Phenotypic diversity & epigenetics.

OEB 192 – Evolution of pathogens (Grenfell et al., Science)

What can sequences tell us? BIOL E-127– 10/15/07.

OEB 192 – “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical.

BIOS E-127 – Pleiotropy & specialization.

Upcoming Seminars This Friday Dr. Barry Stoddard from the FHCRC will visit WWU and give a seminar entitled: "Homing endonucleases: reagents for gene targeting"

OEB 192 – Phenotypic diversity & epigenetics.

How follow diversification? MLST for Streptococcus pneumoniae (Fraser et al., 2007) (Feil, 2003) OEB 192 –

BA271 Week 9 Lecture Using forms in Access. Status Report … Review where we are … –Midterm – Graded! –Final websites – Graded! –Access #1 – Graded! –Access.

January 2012 Monday Tuesday Wednesday Thursday Friday Sat/ Sun / /8 14/15 21/22 28/

OEB 192 – Phenotypic diversity & epigenetics.

An example story OEB (Nature 394:69-72)

OEB 192 – How follow diversification? MLST for Streptococcus pneumoniae (Fraser et al., 2007) (Feil, 2003)

More on neutral theory OEB 192 – Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.

OEB 192 – Optimality & evolution of networks.

Detecting HGT: discordant phylogenies OEB 192 –

BIOS E-127 – Prior theme music: “Evolutionary speculation.

OEB 192 – Mutation rate & population size I.

Evolution before Darwin Lamarck: Philosophie Zoologique (1809) OEB 192 – Prior theme music:

First Phylogenetics Assignment: Due Oct 27 th (not Oct. 20 th )

BIOS E-127 – Evolution of digital organisms.

BIOS E-127 – Evolution of microbes. An example story BIOS E-127 – (Nature 394:69-72)

“Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

OEB 192 – Epistasis. (Segrè et al., Nat. Genet.)

Saturday May 02 PST 4 PM. Saturday May 02 PST 10:00 PM.

Genetic exchange in bacteria/archaea OEB 192 – (Worobey et al., 2010, last Friday)

BIOS E-127 – Diversification & co-evolution.

BIOS E-127 – Phenetics vs. cladistics Lysozyme amino acid changes in unrelated ruminants Phenetics vs. cladistics.

Species “Species are groups of actually or potentially interbreeding populations, which are reproductively isolated from other such groups” (Mayr, 1942)

BIOS E-127 – Physiological basis of fitness & optimality.

Flight Traveling By Emily. Surabaya – Auckland Departure time: Monday, September 29 th at 3:00 a.m. Length of flight: 9 hours and 16 minutes Auckland.

Class Schedule Template SundayMondayTuesdayWednedayThursdayFridaySaturday 6 AM 7 AM 8 AM 9 AM 10 AM 11 AM 12 AM 1 PM 2 PM 3 PM 4 PM 5 PM 6 PM Title Classroom.

2012 Infectious Diseases Fellows Program David M. Aronoff, MD Assoc. Professor Division of Infectious Diseases Department of Internal Medicine Department.

 SC235: Unit 1 Seminar Is it Biotic?. Course Overview  Term: Feb. 2 nd – April 12 th  Course site  Doc sharing  Webliography  Drop box  Communication:

Easter Revision Sessions Monday 14 April English Tuesday 15 April GCSE French 9.00 am – pm – Room 22 GCSE Photography am – 3.00 pm Wednesday.

Garside: SNC2D. The following schedule is for Period 2 Class:

Lynn English High School Ms. Mezzetti

Department of Biotechnology

OEB 192 – Dynamics of adaptation.

Weekly Schedule of Events January 3-9, Sunday, January 3, 2016 Fellowship, 9:15 am Sunday School for all ages, 9:30 Morning Worship Service, 10:45.

An example story BIOL E-127 – 9/24/07 (Nature 394:69-72)

A day in my life By Jack Lupton 7C2. Wake Up I wake up at 7.00 I sometimes have a shower after I get up.

BIO/BCH/MI/PLS/PPA 601 Special Topics in Molecular and Cellular Genetics Brian Rymond, Biology, 335 T.H. Morgan (THM) Biology Bldg.,

HISTORY 348 World War I: Origins, Experience Aftermath Dr Paul Werth MW, AM.

Daily Math Review September 2-6, Monday Solve the following problems with strategies and/or algorithms 5, = 9, = 3, =

By Jayson Park. Goals Navigate to prototype Create a Reservation Navigate to Wednesday 11/9 Make a reservation at 4:00PM to 6:00 PM for room L1108 View.

By Jayson Park. Goals Navigate to prototype Navigate to Wednesday 11/9 Create Reservation at 4:00PM to 6:00 PM Remove reservation View Current Appointments.

My Plan to Go to Around the world By: Benedict/5C.

Need Help With Trig graphs? Then this workshop is for YOU! Where: MS109 When: Wednesday March 16 th and Thursday March 17 th When: 11:30 – 12:30 All Math.

Intro to microbial evolution

Genome Science Theme Seminar

Evolution & Natural Selection

“Stem Cells and Cancer”

Modern Evolutionary Theory

Presentation transcript:

Genetic exchange in bacteria/archaea OEB 192 –

Genetic exchange in bacteria/archaea

Detecting HGT from genomes: atypical nt composition (Hacker & Carniel, 2001)

Monday (9/21): Microbial species, biogeography & population genetics I.

WEDNESDAY, SEPTEMBER 16, 2009 Origins of Life Forum: Irene Chen (Bauer Fellow, FAS Center for Systems Biology, Harvard University) "Information in the Prebiotic World." 4:00-5:00 pm Biological Laboratories Main Lecture Hall (Room 1068) FRIDAY, SEPTEMBER 18, 2009 MSI Chalktalk Breakfast: Colleen Cavanaugh (Edward C. Jeffrey Professor of Biology and MSI Co-Director) “Transmission Strategy of Host-Associated Bacteria: Ecological and Evolutionary Consequences” 8:30-9:30 am (coffee/tea/pastries at 8:30 am) HUCE, 24 Oxford St. TUESDAY, SEPTEMBER 22, 2009 HMS Microbiology & Molecular Genetics Seminar: Roy Kishony (HMS Systems Biology) “Antibiotic interactions and evolution of resistance” 12:30-1:30 pm 341 Warren Alpert, HMS