Predicting RNA Structure and Function. Following the human genome sequencing there is a high interest in RNA “Just when scientists thought they had deciphered.

Slides:



Advertisements
Similar presentations
RNA Secondary Structure Prediction
Advertisements

Gene expression From Gene to Protein
RNA structure prediction. RNA functions RNA functions as –mRNA –rRNA –tRNA –Nuclear export –Spliceosome –Regulatory molecules (RNAi) –Enzymes –Virus –Retrotransposons.
Improving miRNA Target Genes Prediction Rikky Wenang Purbojati.
MiRNA in computational biology 1 The Nobel Prize in Physiology or Medicine for 2006 Andrew Z. Fire and Craig C. Mello for their discovery of "RNA interference.
RNA Structure Prediction
Predicting RNA Structure and Function. Non coding DNA (98.5% human genome) Intergenic Repetitive elements Promoters Introns mRNA untranslated region (UTR)
Predicting RNA Structure and Function
RNA structure prediction. RNA functions RNA functions as –mRNA –rRNA –tRNA –Nuclear export –Spliceosome –Regulatory molecules (RNAi) –Enzymes –Virus –Retrotransposons.
. Class 1: Introduction. The Tree of Life Source: Alberts et al.
Introduction to Bioinformatics - Tutorial no. 9 RNA Secondary Structure Prediction.
RNA Secondary Structure Prediction
Predicting RNA Structure and Function. Nobel prize 1989Nobel prize 2009 Ribozyme Ribosome RNA has many biological functions The function of the RNA molecule.
Presenting: Asher Malka Supervisor: Prof. Hermona Soreq.
MicroRNA genes Ka-Lok Ng Department of Bioinformatics Asia University.
[Bejerano Fall10/11] 1.
. Class 5: RNA Structure Prediction. RNA types u Messenger RNA (mRNA) l Encodes protein sequences u Transfer RNA (tRNA) l Adaptor between mRNA molecules.
1 Ref: Ch. 5 Mount: Bioinformatics i.Protein synthesis: ribosomal RNA transfer RNA messenger RNA ii.Catalysis e.g. ribozymes iii.Regulatory molecules 17.1.
Predicting RNA Structure and Function
UTR motifs and microRNA analysis 曾 大 千 助 理 教 授 10/28/2008.
Predicting RNA Structure and Function. Nobel prize 1989 Nobel prize 2009 Ribozyme Ribosome.
RNA.
More regulating gene expression. Fig 16.1 Gene Expression is controlled at all of these steps: DNA packaging Transcription RNA processing and transport.
RNA-Seq and RNA Structure Prediction
RNA informatics Unit 12 BIOL221T: Advanced Bioinformatics for Biotechnology Irene Gabashvili, PhD.
Non-coding RNA gene finding problems. Outline Introduction RNA secondary structure prediction RNA sequence-structure alignment.
The Search for Small Regulatory RNA Central Dogma: DNA to RNA to Protein Replication Processing / Translocation hnRNA rRNAtRNA mRNA.
Transcription Transcription is the synthesis of mRNA from a section of DNA. Transcription of a gene starts from a region of DNA known as the promoter.
MicroRNA Targets Prediction and Analysis. Small RNAs play important roles The Nobel Prize in Physiology or Medicine for 2006 Andrew Z. Fire and Craig.
1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.
Genomics and Personalized Care in Health Systems Lecture 9 RNA and Protein Structure Leming Zhou, PhD School of Health and Rehabilitation Sciences Department.
Structure and function of nucleic acids.. Heat. Heat flows through the boundary of the system because there exists a temperature difference between the.
From Structure to Function. Given a protein structure can we predict the function of a protein when we do not have a known homolog in the database ?
RNA folding & ncRNA discovery I519 Introduction to Bioinformatics, Fall, 2012.
RNA Folding. RNA Folding Algorithms Intuitively: given a sequence, find the structure with the maximal number of base pairs For nested structures, four.
1 Classification of real and pseudo microRNA precursors using local structure-sequence features and support vector machine Chenghai Xue, Fei Li, Tao He,
1Introduction 2Theoretical background Biochemistry/molecular biology 3Theoretical background computer science 4History of the field 5Splicing systems.
RNA Secondary Structure Prediction. 16s rRNA RNA Secondary Structure Hairpin loop Junction (Multiloop)Bulge Single- Stranded Interior Loop Stem Image–
© Wiley Publishing All Rights Reserved. RNA Analysis.
RNA Structure Prediction
Protein and RNA Families
Questions?. Novel ncRNAs are abundant: Ex: miRNAs miRNAs were the second major story in 2001 (after the genome). Subsequently, many other non-coding genes.
Mark D. Adams Dept. of Genetics 9/10/04
Transcription and mRNA Modification
Cell Protein Production. Transcription : process of mRNA formation. 1. Triggered by chem. messengers from cytoplasm which bind to DNA 2. This causes release.
RNA Structure Prediction RNA Structure Basics The RNA ‘Rules’ Programs and Predictions BIO520 BioinformaticsJim Lund Assigned reading: Ch. 6 from Bioinformatics:
This seems highly unlikely.
Motif Search and RNA Structure Prediction Lesson 9.
Classification of real and pseudo microRNA precursors using local structure-sequence features and support vector machine 朱林娇 14S
Tracking down ncRNAs in the genomes. How to find ncRNA gene The stability of ncRNA secondary structure is not sufficiently different from the predicted.
MicroRNA Prediction with SCFG and MFE Structure Annotation Tim Shaw, Ying Zheng, and Bram Sebastian.
Abstract Premise Figure 1: Flowchart pri-miRNAs were collected from miRBase 10.0 pri-miRNAs were compared to hsa and ptr genomes using BlastN and potential.
RNA Structure Prediction
Rapid ab initio RNA Folding Including Pseudoknots via Graph Tree Decomposition Jizhen Zhao, Liming Cai Russell Malmberg Computer Science Plant Biology.
Lecture 8.21 Lecture 8.2: RNA Jennifer Gardy Centre for Microbial Diseases and Immunity Research University of British Columbia
RNA MODIFICATION Eukaryotic mRNA molecules are modified before they exit the nucleus.
RNAs. RNA Basics transfer RNA (tRNA) transfer RNA (tRNA) messenger RNA (mRNA) messenger RNA (mRNA) ribosomal RNA (rRNA) ribosomal RNA (rRNA) small interfering.
AAA AAAU AAUUC AUUC UUCCG UCCG CCGG G G Karen M. Pickard CISC889 Spring 2002 RNA Secondary Structure Prediction.
Date of download: 7/10/2016 Copyright © 2016 McGraw-Hill Education. All rights reserved. Basic steps of gene expression—transcription factors regulate.
Gene Expression Analysis
miRNA genomic organization, biogenesis and function
Lab 8.3: RNA Secondary Structure
Predicting RNA Structure and Function
RNA Secondary Structure Prediction
Chapter 15 The Genetic Code
Identification and Characterization of pre-miRNA Candidates in the C
mRNA Degradation and Translation Control
RNA 2D and 3D Structure Craig L. Zirbel October 7, 2010.
Gene Expression: From Gene to Protein
Noncoding RNA roles in Gene Expression
Presentation transcript:

Predicting RNA Structure and Function

Following the human genome sequencing there is a high interest in RNA “Just when scientists thought they had deciphered the roles played by the cell's leading actors, a familiar performer has turned up in a stunning variety of guises. RNA, long upstaged by its more glamorous sibling, DNA, is turning out to have star qualities of its own “ SCINECE NEWS 12: 2002

Ribozyme

The Ribosome : The protein factory of the cell mainly made of RNA

Non coding DNA (98.5% human genome) Intergenic Repetitive elements Promoters Introns untranslated region (UTR)

Some biological functions of ncRNA mRNA cellular localization Control of mRNA stability Control of splicing Control of translation The function of the RNA molecule depends on its folded structure

RNA Structural levels tRNA Secondary Structure Tertiary Structure

Control of Iron levels by mRNA structure G U A G C N N N’ C N N’ 5’3’ conserved Iron Responsive Element IRE Recognized by IRP1, IRP2

IRP1/2 5’ 3’ F mRNA 5’ 3’ TR mRNA IRP1/2 F: Ferritin = iron storage TR: Transferin receptor = iron uptake IRE Low Iron IRE-IRP inhibits translation of ferritin IRE-IRP Inhibition of degradation of TR High Iron IRE-IRP off -> ferritin translated Transferin receptor degradated

RNA Secondary Structure U U C G U A A U G C 5’ 3’ 5’ G A U C U U G A U C 3’ STEM LOOP The RNA molecule folds on itself. The base pairing is as follows: G C A U G U hydrogen bond.

RNA Secondary structure Short Range Interactions G G A U U G C C G G A U A A U G C A G C U U INTERNAL LOOP HAIRPIN LOOP BULGE STEM DANGLING ENDS 5’3’

long range interactions of RNA secondary structural elements Pseudo-knot Kissing hairpins Hairpin-bulge contact These patterns are excluded from the prediction schemes as their computation is too intensive.

Predicting RNA secondary Structure Searching for a structure with Minimal Free Energy (MFE) According to base pairing rules only Watson Crick A-T G-C and wobble pairs G-T can from stems

Simplifying Assumptions for Structure Prediction RNA folds into one minimum free-energy structure. There are no knots (base pairs never cross). The energy of a particular base pair in a double stranded regions is calculated independently –Neighbors do not influence the energy. Solution : Searching for MFE with Dynamic Programming Zucker and Steigler 1981

Sequence dependent free-energy values of the base pairs (nearest neighbor model) U U C G G C A U G C A UCGAC 3’ 5’ U U C G U A A U G C A UCGAC 3’ 5’ Assign negative energies to interactions between base pair regions. Energy is influenced by the previous base pair (not by the base pairs further down).

Sequence dependent free-energy values of the base pairs (nearest neighbor model) U U C G G C A U G C A UCGAC 3’ 5’ U U C G U A A U G C A UCGAC 3’ 5’ Example values: GC GC AU GC CG UA These energies are estimated experimentally from small synthetic RNAs.

Adding Complexity to Energy Calculations Positive energy - added for destabilizing regions such as bulges, loops, etc. More than one structure can be predicted

Free energy computation U U A G C A G C U A A U C G A U A 3’ A 5’ mismatch of hairpin -2.9 stacking nt bulge -2.9 stacking -1.8 stacking 5’ dangling -0.9 stacking -1.8 stacking -2.1 stacking G= -4.6 KCAL/MOL nt loop

Prediction Tools based on Energy Calculation Fold, Mfold Zucker & Stiegler (1981) Nuc. Acids Res. 9: Zucker (1989) Science 244:48-52 RNAfold Vienna RNA secondary structure server Hofacker (2003) Nuc. Acids Res. 31:

Insight from Multiple Alignment Information from multiple sequence alignment (MSA) can help to predict the probability of positions i,j to be base-paired. G C C U U C G G G C G A C U U C G G U C G G C U U C G G C C

Compensatory Substitutions U U C G U A A U G C A UCGAC 3’ G C 5’ Mutations that maintain the secondary structure

RNA secondary structure can be revealed by identification of compensatory mutations G C C U U C G G G C G A C U U C G G U C G G C U U C G G C C U C U G C G N N’ G C

Insight from Multiple Alignment Information from multiple sequence alignment (MSA) can help to predict the probability of positions i,j to be base-paired. Conservation – no additional information Consistent mutations (GC  GU) – support stem Inconsistent mutations – does not support stem. Compensatory mutations – support stem.

RNAalifold (Hofacker 2002) From the vienna RNA package Predicts the consensus secondary structure for a set of aligned RNA sequences by using modified dynamic programming algorithm that add alignment information to the standard energy model Improvement in prediction accuracy

Other related programs COVE RNA structure analysis using the covariance model (implementation of the stochastic free grammar method) QRNA (Rivas and Eddy 2001) Searching for conserved RNA structures tRNAscan-SE tRNA detection in genome sequences Sean Eddy’s Lab WU

RNA families Rfam : General non-coding RNA database (most of the data is taken from specific databases) Includes many families of non coding RNAs and functional motifs, as well as their alignment and their secondary structures

Rfam /Pfam Pfam uses the HMMER (based on Hidden Markov Models) Rfam uses the INFERNAL (based on Covariation Model)

Rfam (currently version 7.0) 503 different RNA families or functional Motifs from mRNA, UTRs etc.  View and download multiple sequence alignments  Read family annotation  Examine species distribution of family members  Follow links to otherdatabases

An example of an RNA family miR-1 MicroRNAs mir-1 microRNA precursor family This family represents the microRNA (miRNA) mir-1 family. miRNAs are transcribed as ~70nt precursors (modelled here) and subsequently processed by the Dicer enzyme to give a ~22nt product. The products are thought to have regulatory roles through complementarity to mRNA.

Seed alignment (based on 7 sequences)

BACK TO PROTEINS

Predicting Protein function Expression data Protein Structure 32

wt other RNA processing export splicing transcription decay splicing Microarray data for yeast genes

34 Using SVMs to predict function based on expression data Each dot represents a vector of the expression pattern taken from a microarray experiment. For example the expression pattern of all genes coding for proteins involved in splicing Splicing factors others

35 How do SVM’s work with expression data? In this example blue dots can be proteins involved in splicing and red are all the rest kernel The SVM is trained on experimentally verified data

? After training the SVM we can use it to predict hypothetical genes based on their expression pattern How do SVM’s work with expression data? In this example blue dots can be proteins involved in splicing and red are all the rest

Structural Genomics : a large scale structure determination project designed to cover all representative protein structures Zarembinski, et al., Proc.Nat.Acad.Sci.USA, 99:15189 (1998) ATP binding domain of protein MJ0577 Predicting function from structure

As a result of the Structure Genomic initiative many structures of proteins with unknown function will be solved Wanted ! Automated methods to predict function from the protein structures resulting from the structural genomic project.

Approaches for predicting function from structure ConSurf - Mapping the evolution conservation on the protein structure

Approaches for predicting function from structure PHPlus – Identifying positive electrostatic patches on the protein structure

Approaches for predicting function from structure SHARP2 – Identifying positive electrostatic patches on the protein structure

42 ALL TOGETHER….