DNA Sequencing

CS262 Lecture 9, Win06, Batzoglou DNA Sequencing – gel electrophoresis 1.Start at primer(restriction site) 2.Grow DNA chain 3.Include dideoxynucleoside (modified a, c, g, t) 4.Stops reaction at all possible points 5.Separate products with length, using gel electrophoresis

CS262 Lecture 9, Win06, Batzoglou Electrophoresis diagrams

CS262 Lecture 9, Win06, Batzoglou Method to sequence longer regions cut many times at random (Shotgun) genomic segment Get one or two reads from each segment ~500 bp

CS262 Lecture 9, Win06, Batzoglou Reconstructing the Sequence (Fragment Assembly) Cover region with ~7-fold redundancy (7X) Overlap reads and extend to reconstruct the original genomic region reads

CS262 Lecture 9, Win06, Batzoglou Definition of Coverage Length of genomic segment:L Number of reads: n Length of each read:l Definition: Coverage C = n l / L How much coverage is enough? Lander-Waterman model: Assuming uniform distribution of reads, C=10 results in 1 gapped region /1,000,000 nucleotides C

CS262 Lecture 9, Win06, Batzoglou Repeats Bacterial genomes:5% Mammals:50% Repeat types: Low-Complexity DNA (e.g. ATATATATACATA…) Microsatellite repeats (a 1 …a k ) N where k ~ 3-6 (e.g. CAGCAGTAGCAGCACCAG) Transposons  SINE (Short Interspersed Nuclear Elements) e.g., ALU: ~300-long, 10 6 copies  LINE (Long Interspersed Nuclear Elements) ~4000-long, 200,000 copies  LTR retroposons (Long Terminal Repeats (~700 bp) at each end) cousins of HIV Gene Families genes duplicate & then diverge (paralogs) Recent duplications ~100,000-long, very similar copies

CS262 Lecture 9, Win06, Batzoglou Sequencing and Fragment Assembly AGTAGCACAGA CTACGACGAGA CGATCGTGCGA GCGACGGCGTA GTGTGCTGTAC TGTCGTGTGTG TGTACTCTCCT 3x10 9 nucleotides 50% of human DNA is composed of repeats Error! Glued together two distant regions

CS262 Lecture 9, Win06, Batzoglou What can we do about repeats? Two main approaches: Cluster the reads Link the reads

CS262 Lecture 9, Win06, Batzoglou What can we do about repeats? Two main approaches: Cluster the reads Link the reads

CS262 Lecture 9, Win06, Batzoglou What can we do about repeats? Two main approaches: Cluster the reads Link the reads

CS262 Lecture 9, Win06, Batzoglou Sequencing and Fragment Assembly AGTAGCACAGA CTACGACGAGA CGATCGTGCGA GCGACGGCGTA GTGTGCTGTAC TGTCGTGTGTG TGTACTCTCCT 3x10 9 nucleotides C R D ARB, CRD or ARD, CRB ? ARB

CS262 Lecture 9, Win06, Batzoglou Sequencing and Fragment Assembly AGTAGCACAGA CTACGACGAGA CGATCGTGCGA GCGACGGCGTA GTGTGCTGTAC TGTCGTGTGTG TGTACTCTCCT 3x10 9 nucleotides

CS262 Lecture 9, Win06, Batzoglou Strategies for whole-genome sequencing 1.Hierarchical – Clone-by-clone i.Break genome into many long pieces ii.Map each long piece onto the genome iii.Sequence each piece with shotgun Example: Yeast, Worm, Human, Rat 2.Online version of (1) – Walking i.Break genome into many long pieces ii.Start sequencing each piece with shotgun iii.Construct map as you go Example: Rice genome 3.Whole genome shotgun One large shotgun pass on the whole genome Example: Drosophila, Human (Celera), Neurospora, Mouse, Rat, Dog

Hierarchical Sequencing

CS262 Lecture 9, Win06, Batzoglou Hierarchical Sequencing Strategy 1.Obtain a large collection of BAC clones 2.Map them onto the genome (Physical Mapping) 3.Select a minimum tiling path 4.Sequence each clone in the path with shotgun 5.Assemble 6.Put everything together a BAC clone map genome

CS262 Lecture 9, Win06, Batzoglou Methods of physical mapping Goal: Make a map of the locations of each clone relative to one another Use the map to select a minimal set of clones to sequence Methods: Hybridization Digestion

CS262 Lecture 9, Win06, Batzoglou 1. Hybridization Short words, the probes, attach to complementary words 1.Construct many probes 2.Treat each BAC with all probes 3.Record which ones attach to it 4.Same words attaching to BACS X, Y  overlap p1p1 pnpn

CS262 Lecture 9, Win06, Batzoglou Hybridization – Computational Challenge Matrix: m probes  n clones (i, j):1, if p i hybridizes to C j 0, otherwise Definition: Consecutive ones matrix 1s are consecutive in each row & col Computational problem: Reorder the probes so that matrix is in consecutive-ones form Can be solved in O(m 3 ) time (m > n) p 1 p 2 …………………….p m C 1 C 2 ……………….C n 1 0 1………………… ………………… …………………..1 p i1 p i2 …………………….p im C j1 C j2 ……………….C jn …………… …………… …………… ……… ………

CS262 Lecture 9, Win06, Batzoglou Hybridization – Computational Challenge If we put the matrix in consecutive-ones form, then we can deduce the order of the clones & which pairs of clones overlap p i1 p i2 …………………….p im C j1 C j2 ……………….C jn …………… …………… …………… ……… ……… C j1 C j2 ……………….C jn p i1 p i2 ………………………………….p im

CS262 Lecture 9, Win06, Batzoglou Hybridization – Computational Challenge Additional challenge: A probe (short word) can hybridize in many places in the genome Computational Problem: Find the order of probes that implies the minimal probe repetition Equivalent: find the shortest string of probes such that each clone appears as a substring APX-hard Solutions: Greedy, probabilistic, lots of manual curation p 1 p 2 …………………….p m C 1 C 2 ……………….C n 1 0 1………………… ………………… …………………..1

CS262 Lecture 9, Win06, Batzoglou 2.Digestion Restriction enzymes cut DNA where specific words appear 1.Cut each clone separately with an enzyme 2.Run fragments on a gel and measure length 3.Clones C a, C b have fragments of length { l i, l j, l k }  overlap Double digestion: Cut with enzyme A, enzyme B, then enzymes A + B

Online Clone-by-clone The Walking Method

CS262 Lecture 9, Win06, Batzoglou The Walking Method 1.Build a very redundant library of BACs with sequenced clone- ends (cheap to build) 2.Sequence some “seed” clones 3.“Walk” from seeds using clone-ends to pick library clones that extend left & right

CS262 Lecture 9, Win06, Batzoglou Walking: An Example

CS262 Lecture 9, Win06, Batzoglou Advantages & Disadvantages of Hierarchical Sequencing Hierarchical Sequencing  ADV. Easy assembly  DIS. Build library & physical map; redundant sequencing Whole Genome Shotgun (WGS)  ADV. No mapping, no redundant sequencing  DIS. Difficult to assemble and resolve repeats The Walking method – motivation Sequence the genome clone-by-clone without a physical map The only costs involved are:  Library of end-sequenced clones (cheap)  Sequencing

CS262 Lecture 9, Win06, Batzoglou Walking off a Single Seed Low redundant sequencing Many sequential steps

CS262 Lecture 9, Win06, Batzoglou Walking off a single clone is impractical Cycle time to process one clone: 1-2 months 1.Grow clone 2.Prepare & Shear DNA 3.Prepare shotgun library & perform shotgun 4.Assemble in a computer 5.Close remaining gaps A mammalian genome would need 15,000 walking steps !

CS262 Lecture 9, Win06, Batzoglou Walking off several seeds in parallel Few sequential steps Additional redundant sequencing In general, can sequence a genome in ~5 walking steps, with <20% redundant sequencing EfficientInefficient

CS262 Lecture 9, Win06, Batzoglou Using Two Libraries Solution: Use a second library of small clones Most inefficiency comes from closing a small gap with a much larger clone

CS262 Lecture 9, Win06, Batzoglou Some Terminology insert a fragment that was incorporated in a circular genome, and can be copied (cloned) vector the circular genome (host) that incorporated the fragment BAC Bacterial Artificial Chromosome, a type of insert–vector combination, typically of length kb read a long word that comes out of a sequencing machine coverage the average number of reads (or inserts) that cover a position in the target DNA piece shotgun the process of obtaining many reads sequencing from random locations in DNA, to detect overlaps and assemble

CS262 Lecture 9, Win06, Batzoglou Whole Genome Shotgun Sequencing cut many times at random genome forward-reverse paired reads plasmids (2 – 10 Kbp) cosmids (40 Kbp) known dist ~500 bp

CS262 Lecture 9, Win06, Batzoglou Fragment Assembly (in whole-genome shotgun sequencing)

CS262 Lecture 9, Win06, Batzoglou Fragment Assembly Given N reads… Where N ~ 30 million… We need to use a linear-time algorithm

CS262 Lecture 9, Win06, Batzoglou Steps to Assemble a Genome 1. Find overlapping reads 4. Derive consensus sequence..ACGATTACAATAGGTT.. 2. Merge some “good” pairs of reads into longer contigs 3. Link contigs to form supercontigs Some Terminology read a long word that comes out of sequencer mate pair a pair of reads from two ends of the same insert fragment contig a contiguous sequence formed by several overlapping reads with no gaps supercontig an ordered and oriented set (scaffold) of contigs, usually by mate pairs consensus sequence derived from the sequene multiple alignment of reads in a contig

CS262 Lecture 9, Win06, Batzoglou 1. Find Overlapping Reads aaactgcagtacggatct aaactgcag aactgcagt … gtacggatct tacggatct gggcccaaactgcagtac gggcccaaa ggcccaaac … actgcagta ctgcagtac gtacggatctactacaca gtacggatc tacggatct … ctactacac tactacaca (read, pos., word, orient.) aaactgcag aactgcagt actgcagta … gtacggatc tacggatct gggcccaaa ggcccaaac gcccaaact … actgcagta ctgcagtac gtacggatc tacggatct acggatcta … ctactacac tactacaca (word, read, orient., pos.) aaactgcag aactgcagt acggatcta actgcagta cccaaactg cggatctac ctactacac ctgcagtac gcccaaact ggcccaaac gggcccaaa gtacggatc tacggatct tactacaca

CS262 Lecture 9, Win06, Batzoglou 1. Find Overlapping Reads Find pairs of reads sharing a k-mer, k ~ 24 Extend to full alignment – throw away if not >98% similar TAGATTACACAGATTAC ||||||||||||||||| T GA TAGA | || TACA TAGT || Caveat: repeats  A k-mer that occurs N times, causes O(N 2 ) read/read comparisons  ALU k-mers could cause up to 1,000,000 2 comparisons Solution:  Discard all k-mers that occur “ too often ” Set cutoff to balance sensitivity/speed tradeoff, according to genome at hand and computing resources available

CS262 Lecture 9, Win06, Batzoglou 1. Find Overlapping Reads Create local multiple alignments from the overlapping reads TAGATTACACAGATTACTGA TAG TTACACAGATTATTGA TAGATTACACAGATTACTGA TAG TTACACAGATTATTGA TAGATTACACAGATTACTGA

CS262 Lecture 9, Win06, Batzoglou 1. Find Overlapping Reads Correct errors using multiple alignment TAGATTACACAGATTACTGA TAGATTACACAGATTATTGA TAGATTACACAGATTACTGA TAG-TTACACAGATTACTGA TAGATTACACAGATTACTGA TAG-TTACACAGATTATTGA TAGATTACACAGATTACTGA TAG-TTACACAGATTATTGA insert A replace T with C correlated errors— probably caused by repeats  disentangle overlaps TAGATTACACAGATTACTGA TAG-TTACACAGATTATTGA TAGATTACACAGATTACTGA TAG-TTACACAGATTATTGA In practice, error correction removes up to 98% of the errors

CS262 Lecture 9, Win06, Batzoglou 2. Merge Reads into Contigs Overlap graph:  Nodes: reads r 1 …..r n  Edges: overlaps (r i, r j, shift, orientation, score) Note: of course, we don’t know the “color” of these nodes Reads that come from two regions of the genome (blue and red) that contain the same repeat

CS262 Lecture 9, Win06, Batzoglou 2. Merge Reads into Contigs We want to merge reads up to potential repeat boundaries repeat region Unique Contig Overcollapsed Contig

CS262 Lecture 9, Win06, Batzoglou 2. Merge Reads into Contigs Ignore non-maximal reads Merge only maximal reads into contigs repeat region

CS262 Lecture 9, Win06, Batzoglou 2. Merge Reads into Contigs Remove transitively inferable overlaps  If read r overlaps to the right reads r 1, r 2, and r 1 overlaps r 2, then (r, r 2 ) can be inferred by (r, r 1 ) and (r 1, r 2 ) rr1r1 r2r2 r3r3

CS262 Lecture 9, Win06, Batzoglou 2. Merge Reads into Contigs

CS262 Lecture 9, Win06, Batzoglou 2. Merge Reads into Contigs Ignore “hanging” reads, when detecting repeat boundaries sequencing error repeat boundary??? b a a b …

CS262 Lecture 9, Win06, Batzoglou Overlap graph after forming contigs Unitigs: Gene Myers, 95

CS262 Lecture 9, Win06, Batzoglou Repeats, errors, and contig lengths Repeats shorter than read length are easily resolved  Read that spans across a repeat disambiguates order of flanking regions Repeats with more base pair diffs than sequencing error rate are OK  We throw overlaps between two reads in different copies of the repeat To make the genome appear less repetitive, try to:  Increase read length  Decrease sequencing error rate Role of error correction: Discards up to 98% of single-letter sequencing errors decreases error rate  decreases effective repeat content  increases contig length

CS262 Lecture 9, Win06, Batzoglou Insert non-maximal reads whenever unambiguous 2. Merge Reads into Contigs

CS262 Lecture 9, Win06, Batzoglou 3. Link Contigs into Supercontigs Too dense  Overcollapsed Inconsistent links  Overcollapsed? Normal density

CS262 Lecture 9, Win06, Batzoglou Find all links between unique contigs 3. Link Contigs into Supercontigs Connect contigs incrementally, if  2 links supercontig (aka scaffold)

CS262 Lecture 9, Win06, Batzoglou Fill gaps in supercontigs with paths of repeat contigs 3. Link Contigs into Supercontigs

CS262 Lecture 9, Win06, Batzoglou 4. Derive Consensus Sequence Derive multiple alignment from pairwise read alignments TAGATTACACAGATTACTGA TTGATGGCGTAA CTA TAGATTACACAGATTACTGACTTGATGGCGTAAACTA TAG TTACACAGATTATTGACTTCATGGCGTAA CTA TAGATTACACAGATTACTGACTTGATGGCGTAA CTA TAGATTACACAGATTACTGACTTGATGGGGTAA CTA TAGATTACACAGATTACTGACTTGATGGCGTAA CTA Derive each consensus base by weighted voting (Alternative: take maximum-quality letter)

CS262 Lecture 9, Win06, Batzoglou Some Assemblers PHRAP Early assembler, widely used, good model of read errors Overlap O(n 2 )  layout (no mate pairs)  consensus Celera First assembler to handle large genomes (fly, human, mouse) Overlap  layout  consensus Arachne Public assembler (mouse, several fungi) Overlap  layout  consensus Phusion Overlap  clustering  PHRAP  assemblage  consensus Euler Indexing  Euler graph  layout by picking paths  consensus

CS262 Lecture 9, Win06, Batzoglou Quality of assemblies Celera’s assemblies of human and mouse

CS262 Lecture 9, Win06, Batzoglou Quality of assemblies—mouse

CS262 Lecture 9, Win06, Batzoglou Quality of assemblies—mouse N50 contig length Terminology: N50 contig length If we sort contigs from largest to smallest, and start Covering the genome in that order, N50 is the length Of the contig that just covers the 50 th percentile.

CS262 Lecture 9, Win06, Batzoglou Quality of assemblies—rat

CS262 Lecture 9, Win06, Batzoglou History of WGA 1982: -virus, 48,502 bp 1995: h-influenzae, 1 Mbp 2000: fly, 100 Mbp 2001 – present  human (3Gbp), mouse (2.5Gbp), rat *, chicken, dog, chimpanzee, several fungal genomes Gene Myers Let’s sequence the human genome with the shotgun strategy That is impossible, and a bad idea anyway Phil Green 1997

CS262 Lecture 9, Win06, Batzoglou Genomes Sequenced