In silico cis-analysis promoter analysis - Promoters and cis-elements - Searching for patterns - Searching redundant patterns.

Slides:

Advertisements

Similar presentations

Exploiting transcription factor binding site clustering to identify cis-regulatory modules involved in pattern formation in the Drosophila genome ECS289A.

Advertisements

PREDetector : Prokaryotic Regulatory Element Detector Samuel Hiard 1, Sébastien Rigali 2, Séverine Colson 2, Raphaël Marée 1 and Louis Wehenkel 1 1 Bioinformatics.

Combined analysis of ChIP- chip data and sequence data Harbison et al. CS 466 Saurabh Sinha.

Bioinformatics Motif Detection Revised 27/10/06. Overview Introduction Multiple Alignments Multiple alignment based on HMM Motif Finding –Motif representation.

Regulatory Motifs. Contents Biology of regulatory motifs Experimental discovery Computational discovery PSSM MEME.

Bioinformatics Finding signals and motifs in DNA and proteins Expectation Maximization Algorithm MEME The Gibbs sampler Lecture 10.

Bioinformatics Dr. Aladdin HamwiehKhalid Al-shamaa Abdulqader Jighly Lecture 3 Finding Motifs Aleppo University Faculty of technical engineering.

Identification of a Novel cis-Regulatory Element Involved in the Heat Shock Response in Caenorhabditis elegans Using Microarray Gene Expression and Computational.

Cis/TF discovery for Arabidopsis Aristotelis Tsirigos NYU Computer Science.

Discriminative Motifs Saurabh Sinha, RECOMB ’02, April Introduction The term “motif” means the common pattern in different binding sites of a transcription.

Transcription factor binding motifs (part I) 10/17/07.

A Very Basic Gibbs Sampler for Motif Detection Frances Tong July 28, 2004 Southern California Bioinformatics Summer Institute.

Microarrays and Cancer Segal et al. CS 466 Saurabh Sinha.

Multidimensional Analysis If you are comparing more than two conditions (for example 10 types of cancer) or if you are looking at a time series (cell cycle.

The Model To model the complex distribution of the data we used the Gaussian Mixture Model (GMM) with a countable infinite number of Gaussian components.

An analysis of “Alignments anchored on genomic landmarks can aid in the identification of regulatory elements” by Kannan Tharakaraman et al. Sarah Aerni.

Bio277 Lab 3: Finding Transcription Factor Binding Motifs Adapted from a Lab Written by Prof Terry Speed Jess Mar Department of Biostatistics Quackenbush.

Indicator Species Analysis

In silico cis-analysis promoter analysis - Promoters and cis-elements - Searching for patterns - Searching redundant patterns.

Biological Sequence Pattern Analysis Liangjiang (LJ) Wang March 8, 2005 PLPTH 890 Introduction to Genomic Bioinformatics Lecture 16.

Whole Genome Polymorphism Analysis of Regulatory Elements in Breast Cancer AAGTCGGTGATGATTGGGACTGCTCT[C/T]AACACAAGCGAGATGAAGAAACTGA Jacob Biesinger Dr.

Promoter Analysis using Bioinformatics, Putting the Predictions to the Test Amy Creekmore Ansci 490M November 19, 2002.

Computational Approaches for Understanding Biological Significance of Microarray Data Liangjiang (LJ) Wang KSU Bioinformatics Center, Biology.

Motif finding : Lecture 2 CS 498 CXZ. Recap Problem 1: Given a motif, finding its instances Problem 2: Finding motif ab initio. –Paradigm: look for over-represented.

Identifying conserved promoter motifs and transcription factor binding sites in plant promoters Endre Sebestyén, ARI-HAS, Martonvásár, Hungary 26th, November,

Motif finding: Lecture 1 CS 498 CXZ. From DNA to Protein: In words 1.DNA = nucleotide sequence Alphabet size = 4 (A,C,G,T) 2.DNA  mRNA (single stranded)

A Statistical Method for Finding Transcriptional Factor Binding Sites Authors: Saurabh Sinha and Martin Tompa Presenter: Christopher Schlosberg CS598ss.

Genome of the week - Deinococcus radiodurans Highly resistant to DNA damage –Most radiation resistant organism known Multiple genetic elements –2 chromosomes,

Claims about a Population Mean when σ is Known Objective: test a claim.

A systems biology approach to the identification and analysis of transcriptional regulatory networks in osteocytes Angela K. Dean, Stephen E. Harris, Jianhua.

Genetic Regulatory Network Inference Russell Schwartz Department of Biological Sciences Carnegie Mellon University.

Proliferation cluster (G12) Figure S1 A The proliferation cluster is a stable one. A dendrogram depicting results of cluster analysis of all varying genes.

Sequence analysis – an overview A.Krishnamachari

Motif finding with Gibbs sampling CS 466 Saurabh Sinha.

Sampling Approaches to Pattern Extraction

Statistical Analysis for Word counting in Drosophila Core Promoters Yogita Mantri April Bioinformatics Capstone presentation.

Bioinformatics Expression profiling and functional genomics Part II: Differential expression Ad 27/11/2006.

CS5263 Bioinformatics Lecture 20 Practical issues in motif finding Final project.

Motifs BCH364C/391L Systems Biology / Bioinformatics – Spring 2015 Edward Marcotte, Univ of Texas at Austin Edward Marcotte/Univ. of Texas/BCH364C-391L/Spring.

Computational Genomics and Proteomics Lecture 8 Motif Discovery C E N T R F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U E.

Localising regulatory elements using statistical analysis and shortest unique substrings of DNA Nora Pierstorff 1, Rodrigo Nunes de Fonseca 2, Thomas Wiehe.

LARVA: An integrative framework for Large-scale Analysis of Recurrent Variants in noncoding Annotations M Gerstein, Yale Slides freely downloadable from.

Finding Transcription Factor Motifs Adapted from a lab created by Prof Terry Speed.

Data Mining the Yeast Genome Expression and Sequence Data Alvis Brazma European Bioinformatics Institute.

Discovery of transcription networks Lecture3 Nov 2012 Regulatory Genomics Weizmann Institute Prof. Yitzhak Pilpel.

How do we represent the position specific preference ? BID_MOUSE I A R H L A Q I G D E M BAD_MOUSE Y G R E L R R M S D E F BAK_MOUSE V G R Q L A L I G.

Exam 2: Rules Section 2.1 Bring a cheat sheet. One page 2 sides. Bring a calculator. Bring your book to use the tables in the back.

Alternative Splicing (a review by Liliana Florea, 2005) CS 498 SS Saurabh Sinha 11/30/06.

Cluster validation Integration ICES Bioinformatics.

Learning Sequence Motifs Using Expectation Maximization (EM) and Gibbs Sampling BMI/CS 776 Mark Craven

. Finding Motifs in Promoter Regions Libi Hertzberg Or Zuk.

Inference with Gene Expression and Sequence Data BMI/CS 776 Mark Craven April 2002.

Lecture 5 Introduction to Sampling Distributions.

Special Topics in Genomics Motif Analysis. Sequence motif – a pattern of nucleotide or amino acid sequences GTATGTACTTACTATGGGTGGTCAACAAATCTATGTATGA TAACATGTGACTCCTATAACCTCTTTGGGTGGTACATGAA.

Computational Biology, Part 3 Representing and Finding Sequence Features using Frequency Matrices Robert F. Murphy Copyright  All rights reserved.

HW4: sites that look like transcription start sites Nucleotide histogram Background frequency Count matrix for translation start sites (-10 to 10) Frequency.

Pattern Discovery and Recognition for Understanding Genetic Regulation Timothy L. Bailey Institute for Molecular Bioscience University of Queensland.

Transcription factor binding motifs (part II) 10/22/07.

1 Discovery of Conserved Sequence Patterns Using a Stochastic Dictionary Model Authors Mayetri Gupta & Jun S. Liu Presented by Ellen Bishop 12/09/2003.

A Very Basic Gibbs Sampler for Motif Detection

Gibbs sampling.

Statistical Inference for the Mean Confidence Interval

Analysis of GO annotation at cluster level by Agnieszka S. Juncker

Estimation Error and Portfolio Optimization

Volume 24, Issue 4, Pages (November 2006)

Genome-wide binding sites of OsMADS1 and the distribution of binding sites in different regions of annotated genes. Genome-wide binding sites of OsMADS1.

Nora Pierstorff Dept. of Genetics University of Cologne

Enrichment analysis of differentially methylated CpGs.

Sequence dependence of Met4 recruitment.

The Bov-A2 element is conserved in the NOS2 gene of bovid species.

Presentation transcript:

In silico cis-analysis promoter analysis - Promoters and cis-elements - Searching for patterns - Searching redundant patterns

What is a promoter? and why care about it? CDS

A little about these cis-elements - Transcription Factors (TF) often bind to them - They are normally from 5-10 bp long - They are often placed in the region from TSS and upstream -Often they come in clusters i.e. must be placed in some ‘syntax’ to be functional -We assume, they are shared by the promoters in a regulon -They are not always conserved 100%

Sound hard to find? it is hard

Some tricks makes it possible Regulon (cluster) Comparing promoters from a regulon to all other promoters i.e. using a negative set (all other promoters in species X) This allows us to use hypergeometric statistics Ranked list of genes The distribution of sequences with a given pattern along a rank i.e. is the pattern overrepresented in promoters with low (or high) p-values in a microarray experiment This allows us to use Kolmogorov-Smirnov Hypergeometric Statistic 10x 5x Takeout 6 balls 1x 5x p=0.04 Kolmogorov-Smirnov, here test for deviations from a uniform distribution of patterns along a sorted list og promoters Occurrence Promoters ranked by e.g. p-value

A cis-element as it might be seen by a TF

So, the elements may not always be 100% conserved If we only had a weight matrice to describe our pattern we could find less conserved patterns With a Gibbs sampler we can work backwards We give it promoters and it builds a weight matrix Motif model (residue frequency x 100): POS A C G T Info weight matrix

●●●●●●●●●●●●●● ●●●●●●●●●● mRNAs OVEREXPRESSED IN mpk4 MUTANT

Gibbs sample evaluation TTGACT Gibbs sampling on 1000 random sampled sets of 17 Arabidopsis promoters, evaluated by information content. monte carlo

GACTTTTC Gibbs sample evaluation Gibbs sampling on 1000 random sampled sets of 17 Arabidopsis promoters, evaluated by information content. monte carlo Here for 8bp patterns

Lebel et al Arabidopsis PR1 promoter

Exams for C th and 7th of december You must attend both exams The exam will take place in aud. 51, building 208 Each exam lasts 2 hours Both exams are open book exams You can bring any book Pocket calculator But no computers