Genome Evolution. Amos Tanay 2009 Genome evolution Lecture 7: Selection in protein coding genes.

Slides:



Advertisements
Similar presentations
IMPRS workshop Comparative Genomics 18 th -21 st of February 2013 Lecture 4 Positive selection.
Advertisements

Quick Lesson on dN/dS Neutral Selection Codon Degeneracy Synonymous vs. Non-synonymous dN/dS ratios Why Selection? The Problem.
Chapter 19 Evolutionary Genetics 18 and 20 April, 2004
Plant of the day! Pebble plants, Lithops, dwarf xerophytes Aizoaceae
Atelier INSERM – La Londe Les Maures – Mai 2004
Signatures of Selection
Molecular Clock I. Evolutionary rate Xuhua Xia
Molecular Evolution Revised 29/12/06
Methods of identification and localization of the DNA coding sequences Jacek Leluk Interdisciplinary Centre for Mathematical and Computational Modelling,
Genetica per Scienze Naturali a.a prof S. Presciuttini Human and chimpanzee genomes The human and chimpanzee genomes—with their 5-million-year history.
Molecular Evolution with an emphasis on substitution rates Gavin JD Smith State Key Laboratory of Emerging Infectious Diseases & Department of Microbiology.
Positive selection A new allele (mutant) confers some increase in the fitness of the organism Selection acts to favour this allele Also called adaptive.
Molecular Clocks, Base Substitutions, & Phylogenetic Distances.
Genome evolution: a sequence-centric approach Lecture 10: Selection in protein coding genes.
Molecular Evolution, Part 2 Everything you didn’t want to know… and more! Everything you didn’t want to know… and more!
. Computational Genomics Lecture #3a (revised 24/3/09) This class has been edited from Nir Friedman’s lecture which is available at
Intro to Comp Genomics Lecture 11: Using models for sequence evolution.
BLOSUM Information Resources Algorithms in Computational Biology Spring 2006 Created by Itai Sharon.
Alignment III PAM Matrices. 2 PAM250 scoring matrix.
Adaptive Molecular Evolution Nonsynonymous vs Synonymous.
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.
Alignment Statistics and Substitution Matrices BMI/CS 576 Colin Dewey Fall 2010.
Molecular phylogenetics
- any detectable change in DNA sequence eg. errors in DNA replication/repair - inherited ones of interest in evolutionary studies Deleterious - will be.
In the deterministic model, the time till fixation depends on the selective advantage, but fixation is guaranteed.
Molecular basis of evolution. Goal – to reconstruct the evolutionary history of all organisms in the form of phylogenetic trees. Classical approach: phylogenetic.
Lecture 25 - Phylogeny Based on Chapter 23 - Molecular Evolution Copyright © 2010 Pearson Education Inc.
Amino Acid Scoring Matrices Jason Davis. Overview Protein synthesis/evolution Protein synthesis/evolution Computational sequence alignment Computational.
Bioinformatics 2011 Molecular Evolution Revised 29/12/06.
Eric C. Rouchka, University of Louisville Sequence Database Searching Eric Rouchka, D.Sc. Bioinformatics Journal Club October.
Pairwise alignment of DNA/protein sequences I519 Introduction to Bioinformatics, Fall 2012.
Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium November 12, 2012.
Lecture 3: population genetics I: mutation and recombination
The Biology and Genetic Base of Cancer. 2 (Mutation)
PHYLOGENETICS CONTINUED TESTS BY TUESDAY BECAUSE SOME PROBLEMS WITH SCANTRONS.
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.
Comp. Genomics Recitation 3 The statistics of database searching.
Construction of Substitution Matrices
Calculating branch lengths from distances. ABC A B C----- a b c.
Sequence Alignment Csc 487/687 Computing for bioinformatics.
Chapter 24: Molecular and Genomic Evolution CHAPTER 24 Molecular and Genomic Evolution.
Identifying and Modeling Selection Pressure (a review of three papers) Rose Hoberman BioLM seminar Feb 9, 2004.
Models of Molecular Evolution III Level 3 Molecular Evolution and Bioinformatics Jim Provan Page and Holmes: Sections 7.5 – 7.8.
Pairwise Sequence Analysis-III
Using blast to study gene evolution – an example.
Cédric Notredame (08/12/2015) Molecular Evolution Cédric Notredame.
Chapter 10 Phylogenetic Basics. Similarities and divergence between biological sequences are often represented by phylogenetic trees Phylogenetics is.
Selectionist view: allele substitution and polymorphism
N=50 s=0.150 replicates s>0 Time till fixation on average: t av = (2/s) ln (2N) generations (also true for mutations with negative “s” ! discuss among.
NEW TOPIC: MOLECULAR EVOLUTION.
Construction of Substitution matrices
By Mireya Diaz Department of Epidemiology and Biostatistics for EECS 458.
Molecular evolution Part I: The evolution of macromolecules.
Ayesha M.Khan Spring Phylogenetic Basics 2 One central field in biology is to infer the relation between species. Do they possess a common ancestor?
The statistics of pairwise alignment BMI/CS 576 Colin Dewey Fall 2015.
Testing the Neutral Mutation Hypothesis The neutral theory predicts that polymorphism within species is correlated positively with fixed differences between.
In populations of finite size, sampling of gametes from the gene pool can cause evolution. Incorporating Genetic Drift.
Modelling evolution Gil McVean Department of Statistics TC A G.
Lecture 21: Introduction to Phylogenetics November 9, 2015.
Substitution Matrices and Alignment Statistics BMI/CS 776 Mark Craven February 2002.
Detection of the footprint of natural selection in the genome
Evolution of gene function
The neutral theory of molecular evolution
Neutrality Test First suggested by Kimura (1968) and King and Jukes (1969) Shift to using neutrality as a null hypothesis in positive selection and selection.
Linkage and Linkage Disequilibrium
The Neutral Theory M. Kimura, 1968
Pipelines for Computational Analysis (Bioinformatics)
Molecular basis of evolution.
Detection of the footprint of natural selection in the genome
Presentation transcript:

Genome Evolution. Amos Tanay 2009 Genome evolution Lecture 7: Selection in protein coding genes

Genome Evolution. Amos Tanay 2009 Protein genes: codes and structure 123 codons Introns/exons Domains Conformation Degenerate code Recombination easier? Epistasis: fitness correlation between two remote loci 5’ utr3’ utr

Genome Evolution. Amos Tanay 2009 Identifying protein coding genes From mRNAs Spliced ESTs : short low quality fragments that are easier to get Using computational methods. Limited accuracy Using conservation or mapping from other genomes

Genome Evolution. Amos Tanay 2009 Questions on protein function and evolution Identification: Identify protein coding genes –Not yet resolved for new species, but with new technology this question may be less important than before Structure/Function: Define functional domains –Highly important for understanding protein function Which parts of the proteins are “important” (e.g., catalytic?) –Difficult since structural modeling is hard and context dependent Evolution Identify places and times where a new protein feature emerged –Positive selection Understand mutation/selection through codon degeneracy Understanding processes of duplication and diversitification

Genome Evolution. Amos Tanay 2009 The classical analysis paradigm BLAT/BLAST Target sequence Genbank Matching sequences CLUSTALW ACGTACAGA ACGT--CAGA ACGTTCAGA ACGTACGGA Alignment Phylogenetic Modeling Analysis: rate, Ka/Ks…

Genome Evolution. Amos Tanay 2009 Basics: rates of substitution We observe two sequences The divergence D is the fraction of different amino acids We want to find the rate of replacement (or substitution) D So if we computed the divergence D of two sequence, we can estimate the rate Where L is the sequence length. Note that for small D’s, K~D, but for larger values, K takes into account multiple substitutions And:

Genome Evolution. Amos Tanay 2009 Basics: rates of substitution - nucleotides With nucleotides, we cannot ignore mutations that eliminate divergence Probability to have the same value after two branches of length t: So we can estimate the rate given the observed divergence d: A CT G      A CT G      Jukes-Kantor (JK) Kimura

Genome Evolution. Amos Tanay 2009 Using universal matrices: PAM/BLOSSOM62 Given a multiple alignment (of protein coding DNA) we can convert the DNA to proteins. We can then try to model the phylogenetic relations between the proteins using a fixed rate matrix Q, some phylogeney T and branch lengths t i When modeling hundreds/thousands amino acid sequences, we cannot learn from the data the rate matrix (20x20 parameters!) AND the branch lengths AND the phylogeny. Based on surveys of high quality aligned proteins, Margaret Dayhoff and colleuges generated the famous PAM (Point Accepted mutations): PAM1 is for 1% substitution probability. Using conserved aligned blocks, Henikoff and Henikoff generated the BLOSUM family of matrices. Henikoff approach improved analysis of distantly related proteins, and is based on more sequence (lots of conserved blocks), but filtering away highly conserved positions (BLOSUM62 filter anything that is more than 62% conserved) S. Henikoff

Genome Evolution. Amos Tanay 2009 Universal amino-acid substitution rates? Jordan et al., Nature 2005 “We compared sets of orthologous proteins encoded by triplets of closely related genomes from 15 taxa representing all three domains of life (Bacteria, Archaea and Eukaryota), and used phylogenies to polarize amino acid substitutions. Cys, Met, His, Ser and Phe accrue in at least 14 taxa, whereas Pro, Ala, Glu and Gly are consistently lost. The same nine amino acids are currently accrued or lost in human proteins, as shown by analysis of non- synonymous single-nucleotide polymorphisms. All amino acids with declining frequencies are thought to be among the first incorporated into the genetic code; conversely, all amino acids with increasing frequencies, except Ser, were probably recruited late. Thus, expansion of initially under-represented amino acids, which began over 3,400 million years ago, apparently continues to this day. “

Genome Evolution. Amos Tanay 2009 Learning a rate matrix Learning is easy for a single, fixed length branch. Given (inferred) statistics n k for multiple branch lengths, we must optimize a non linear likelihood function Use generic optimization methods: (BFGS)

Genome Evolution. Amos Tanay 2009 Molecular clocks and lineage acceleration How universal is the rate of the evolutionary process? Mutations may depend on the number of cell division and thus in the length of generation Mutations depends on the genomic machinery to prevent them ( Mutations may also depend on the environment The molecular clock (MC) hypothesis state that evolution is working in a similar rate for all lineages ABC O Relative rate test: K OA – K OB = 0 ? Test: K CA – K CB

Genome Evolution. Amos Tanay 2009 Different molecular clocks Kim et al., 2006 PLoS genet in apes and primates Cytochrom C: 5 substiutions per 100 residues per 100 million years Hemoglobin: 20 substiutions per 100 residues per 100 million years Fibrinopeptiedes: 80 substiutions per 100 residues per 100 million years

Genome Evolution. Amos Tanay 2009 Analysis: rate variation If our ML model include rate variation, we can use the inferred rates to annotate the protein Same can be done by constructing a conservation profile, even if the model is simplistic. Shown here are example from Tal Pupko’s work on the Rate4Site and ConSurf programs

Genome Evolution. Amos Tanay 2009 Synonymous vs. non synonymous mutations Degenerate positions of codon are evolving more rapidly – free from selection on the coding sequence This provide us with a powerful “internal control” – we are comparing two different types of evolutionary events at the same loci, so all sources of variation in the mutational process are not affecting us. Given aligned proteins, we can count: M A – number of non-synonymous changes M s – number of synonymous changes We then want to estimate: Ka – rate of non-synonymous mutations (per syn site) Ks – rate of synonymous mutations (per syn site) Estimate V(Ka), V(Ks) Comparing Ka and Ks can provide evolutionary insights: –Ka/Ks<<1: negative selection may be purging protein modifying mutations –Ks/Ka>>1: positive selection may help acquiring a new function –(statistics using, e.g., T-test) Non-SynSyn ChangeMAMA MSMS No Change N A -M A N S -M S Chi-square test Average number of sites

Genome Evolution. Amos Tanay 2009 From dN/dS to Ka and Ks Consider the divergence of synonymous and non synonymous sites separately. As discussed before, we can estimate the rates: A more realistic approach should consider the genetic code and other effect A codon model is defining a rate matrix over nucleotide triplets We can use various parameterizations, for example: For transitionsFor non-synonymous We learn the ML parameters. Small  indicate selection

Genome Evolution. Amos Tanay 2009 Codon bias Different codons appears in significantly different frequencies, which is not expected assuming neutrality Bias is measured in several ways, most popular is the codon adaptation index: Possible sources of bias: –Selection for translational efficiency given different tRNA abudnances Highly expressed genes tend to have stronger codon adaptation indices –Sequence context mutational effects E.g. CpGs are highly mutable –Selection for low insertion/deletion potential Weak selection for codon bias should be stronger for genomes with larger effective population size. In some cases this is true Codon frequency divided by the frequency of the synonymous codon with maximal frequency

Genome Evolution. Amos Tanay 2009 Positive selection in humans vs chimp Nielsen et al., 2005 PloS Biol Testis genes: P< Immunity genes, Gematogenesis, Olfaction P<1e-5 Inhibition of apoptosis P<0.005 Sensory perception P<0.02 Kn vs Ks Looking at trends for families of genes Significantly enriched functions/tissuesExample

Genome Evolution. Amos Tanay 2009 Mcdonald-Kreitman test Possible neutral replacement mutations Possible neutral synonymous mutations Deleterious mutations Expected ratio of replacement to synonymous fixed mutations Expected ratio of replacement to synonymous polymorphic mutations Outgroup TwTw TbTb Replacement Synonymous FixedPoly M. Kreitman

Genome Evolution. Amos Tanay 2009 Mcdonald-Krietman test - example Works by comparing Ka/Ks divergence between species and Ka/Ks diversity among species populations Negative selection should make the divergence Ka/Ks smaller than the diversity Ka/Ks Positive selection should drive the opposite effect Busstamente et al, Nature 2005 human chimp

Genome Evolution. Amos Tanay 2009 Reminder: the coalescent Present Past Theorem: The amount of time during which there are k lineages, t k has approximately an exponential distribution with mean 2N * (2/(k(k-1))) In the infinite sites model, mutations occur at distinct sites. Back in time Coalescent: mutation:

Genome Evolution. Amos Tanay 2009 Infinite sites model Theorem: Let u be the mutation rate for a locus under consideration, and set  =4Nu. Under the infinite sites model, the expected number of segregating sites is: Proof: Let t j be the amount of time in the coalescent during which there are j lineages. We showed earlier that t j has approximately an exponential distribution with mean 2/(j(j-1)). The total amount of time in the tree for a sample size n is: Mutations occur at rate 2Nu:

Genome Evolution. Amos Tanay 2009 Infinite sites model Theorem:  =4Nu. Under the infinite sites model, the number of segregating sites S n has Proof: Let s j be the number of segregating sites created when there were j lineages. While there are j lineages, we may get mutations at rate 2Nuj, and coalescence at rate j(j-1)/2. Mutations occur before coalescence with probability: k successes: It’s a shifted geometric distribution:

Genome Evolution. Amos Tanay 2009 The HKA test (Hudson, Kreitman, Aguade) human chimp human chimp human chimp Slow Fast Purifying Selection Number of segregating sites in locus i and population A and B (Polymorphism) L loci are sequenced in populations A and B Each locus is supposed to be behaving as an infinite site locus Number of difference between two random gametes from A and B (Divergence) Our null hypothesis is of neutral evolution for T’ generations with population sizes 2N and 2Nf, but starting from a single ancestral population of size 2N(1+f)/2 We do not know: We want to allow different loci to have different mutation rates What is the expected divergence?

Genome Evolution. Amos Tanay 2009 The HKA test (Hudson, Kreitman, Aguade) B Number of segregating sites in locus i and population A and B (Polymorphism) Number of difference between two random gametes from A and B (Divergence) A Divergence Is a Poisson variable Coalescent in ancestral population Variance of Poisson variable Variance of S with n=2

Genome Evolution. Amos Tanay 2009 The HKA test (Hudson, Kreitman, Aguade) Number of segregating sites in locus i and population A and B (Polymorphism) Number of difference between two random gametes from A and B (Divergence) There are L+2 parameters that we should estimate. This can be done by solving the equations: Find

Genome Evolution. Amos Tanay 2009 The HKA test (Hudson, Kreitman, Aguade) Number of segregating sites in locus i and population A and B (Polymorphism) Number of difference between two random gametes from A and B (Divergence) The goodness of fit can be expressed as: Significance is best tested using simulations (although we can assume normality and independence and use chi square with 3L-(L+2) degrees of freedom)

Genome Evolution. Amos Tanay 2009 Example: Drosophila chromosome 4 human chimp human chimp human chimp Slow Fast Purifying Selection Collecting data from a target locus: Size, Polymorphism, divergence Collecting data from a control neutral locus: Size, Polymorphism, divergence ci D 5’ Adh Nucs Polymorphic030 Divergence5478 This data is unlikely given our model, why? Population dynamics? (small turns bigger?) Selective sweeps? Mutational effects (gene conversion?)

Genome Evolution. Amos Tanay 2009 Impact of local recombination rate Presgraves 2005 In drosophila, we find strong correlation between recombination rate and the level of polymorphism: High recombination regions have high polymorphism Low recombination region have low polymorphism One possible reason is that high recombination makes mutation rate higher If this was the reason, we should have observe correlation of recombination and divergence But divergence and recombination are not correlated The explanation may therefore be more efficient purifying selection in low recombination regions We indeed see high dN/dS in high recombination – more efficient fixation of beneficial mutations

Genome Evolution. Amos Tanay 2009 Compensatory mutations in proteins? PDB structures Homology modelling 3-Alignments Pairs of interacting residues RatMouseHuman Choi et al, Nat Genet 2005 Find pairs of mutations in interacting residues (DRIP) Coupled: occurring in the same lineage Uncoupled: occurring in different lineages

Genome Evolution. Amos Tanay 2009 Codon volatility Volatility is the number/fraction of adjacent non-synonymous codons Genes under positive selection may have increased volatility Think about the distance from the stationary codon distribution No need to align!! Plotkin et al, Nature 2004

Genome Evolution. Amos Tanay 2009 Using extensive polymorphisms and haplotype data, the most recent examples of positive selection: Sabeti et al, Nature 2007 the analysis reveals more than 300 strong candidate regions. Focusing on the strongest 22 regions, we develop a heuristic for scrutinizing these regions to identify candidate targets of selection. In a complementary analysis, we identify 26 non- synonymous, coding, single nucleotide polymorphisms showing regional evidence of positive selection. Examination of these candidates highlights three cases in which two genes in a common biological process have apparently undergone positive selection in the same population:LARGE and DMD, both related to infection by the Lassa virus3, in West Africa;SLC24A5 and SLC45A2, both involved in skin pigmentation4, 5, in Europe; and EDAR and EDA2R, both involved in development of hair follicles6, in Asia.34, 56

Genome Evolution. Amos Tanay 2009 Time resolution of different positive selection methods Sabeti et al, Science 2005