Genetic exchange in bacteria/archaea OEB 192 – 10.09.20 (Worobey et al., 2010, last Friday)

Slides:

Advertisements

Similar presentations

February 11, 2012 Seth Bordenstein Departments of Biological Sciences & Pathology, Microbiology, and Immunology Seth Bordenstein.

Advertisements

Ortholog vs. paralog? 1. Collect Sequence Data Good Dataset

T h e K i n e t i c T h e o r y. E x p l a i n s t h e e f f e c t s o f t e m p e r a t u r e a n d p r e s s u r e o n m a t t e r.

OEB 192 – Tradeoffs, specialization & pleiotropy.

BIOS E-127– Evolution of pathogens (Grenfell et al., 2004)

BIOS E-127 – Evolution of digital organisms.

Detecting HGT: unlikely presence/absence HGT onlyLoss only (Koonin, 2003) Ex: glycerol-3-P DH OEB 192 –

OEB 192 – Tradeoffs, specialization & pleiotropy.

An example story OEB (Nature 394:69-72)

OEB 192 – Phenotypic diversity & epigenetics.

OEB 192 – Evolution of pathogens (Grenfell et al., Science)

What can sequences tell us? BIOL E-127– 10/15/07.

OEB 192 – Phenotypic diversity & epigenetics.

An example story OEB (Nature 394:69-72)

Selection on codons OEB Degenerate Code.

OEB 192 – How follow diversification? MLST for Streptococcus pneumoniae (Fraser et al., 2007) (Feil, 2003)

More on neutral theory OEB 192 – Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.

OEB 192 – Optimality & evolution of networks.

Detecting HGT: discordant phylogenies OEB 192 –

OEB 192 – Mutation rate & population size I.

Photosynthetic genes in cyanophage Lindell et al.PNAS 2004.

First Phylogenetics Assignment: Due Oct 27 th (not Oct. 20 th )

Genetic exchange in bacteria/archaea OEB 192 –

“Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

OEB 192 – Epistasis. (Segrè et al., Nat. Genet.)

1. How does conjugation work? Sex in Bacteria How do bacteria exchange DNA.

Selection upon codons BIOS E *Aside: shallow trees are strange… And ignore question 7. of assignment…

BIOS E-127 – Diversification & co-evolution.

BIOS E-127 – Phenetics vs. cladistics Lysozyme amino acid changes in unrelated ruminants Phenetics vs. cladistics.

Species “Species are groups of actually or potentially interbreeding populations, which are reproductively isolated from other such groups” (Mayr, 1942)

The phylogenetics project data revealed! October 4, 2010 OEB 192.

Lincoln Middle School Announcements for Friday, October 18, 2013.

If you would like to donate cookies for Coffee Fellowship, please see Pat Shipley.

1. How does conjugation work? Sex in Bacteria How do bacteria exchange DNA.

1 Psychology 320: Psychology of Gender and Sex Differences Lecture 15.

Contacts During sessions: Out of hours : Welcome to our December 2015 Newsletter Newsletter.

OEB 192 – Dynamics of adaptation.

UNIT 3: GENETICS: The study of genes, heredity, and variation.

An example story BIOL E-127 – 9/24/07 (Nature 394:69-72)

No reference available

Clones and the Human Genome Project Unit 11 Lesson 3.

U.S. History Wednesday, through Friday, Welcome Basic Rules: No Food/Drink (Breakfast 1 st Period; Be on Time; Cell Phones; school rules)

A day in my life By Jack Lupton 7C2. Wake Up I wake up at 7.00 I sometimes have a shower after I get up.

7 Characteristics of Life. 1. Cells All living things are made up of cells Cells are the building blocks of life.

Employee Campaign Managers - You can download and use these templates for various fundraising events to support your United Way workplace campaign. Just.

The genomic democracy of sex. Genetic variability Mutation Gene flow Sex.

Introduction to Meiosis. Diploid Diploid is what a cell is called when it has both copies (2N) of each chromosome (N). The diploid number is abbreviated.

Date: March 8, 2016 Aim #59: How can chromosomal abnormalities cause genetic disorders? HW: 1)Complete Pedigree Packet 2)Classical Genetics Quiz Thursday.

By Jayson Park. Goals Navigate to prototype Create a Reservation Navigate to Wednesday 11/9 Make a reservation at 4:00PM to 6:00 PM for room L1108 View.

Do you have Andy’s App? “SAEC” on Apple or Android.

The Hierarchical Organization of Life

Figure 1. (A) Cumulative risk of breast (diamonds) and ovarian (squares) cancer in BRCA1 mutation carriers. (B) Cumulative risk of breast (diamonds) and.

Horizontal gene transfer and the history of life

Genome Evolution: Horizontal Movements in the Fungi

Genomics of epidemic pathogens

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Genome Evolution: Horizontal Movements in the Fungi

Balliol College, Oxford 13th -14th Sept 2016

Genome Science Theme Seminar

Biodiversity BIOLOGY TEAM - SMAMDA By :W. Wulandari.

Meiosis and Sexual Reproduction.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Higher Biology Unit 1: 1.7 Evolution.

3rd Quarter Benchmark Review

Patterns of amino acid usage and its GC-content of synonymous codons in 65 nuclear genomes in this study. Patterns of amino acid usage and its GC-content.

Gut Microbiome Studies

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Expression patterns for teleost-specific whole-genome duplication duplicates of the androgen receptor−signaling pathway in four Lake Tanganyika cichlids,

A, Proportion of variants detected in the MMR genes.

Presentation transcript:

Genetic exchange in bacteria/archaea OEB 192 – (Worobey et al., 2010, last Friday)

Two “types” of HGT…

Comparison of HGT to “normal” sex

Detecting HGT: unlikely presence/absence HGT onlyLoss only (Koonin, 2003) Ex: glycerol-3-P DH

Detecting HGT: differential gene content (Welch et al., 2002)

Detecting HGT from genomes: atypical nt composition (Hacker & Carniel, 2001)

GC% bias across species (Lawrence & Ochman, 1997)

Wednesday (9/22): Limits to HGT

MSI Chalktalk Breakfast **Alternate Location: Haller Hall, Room 102, 1 st floor, 24 Oxford St ** Friday, Sept 24 th 8:45-9:30 am “Evolution of genes at the retrovirus-host interface” Welkin Johnson HMS Host: Cammie Lesser Please join us for coffee and pastries at 8:30 am - Directions to 24 Oxford St: - Join MSI-news listserv: and in the body of your , copy the text: subscribe