BIOS E-127 – 08.09.29. Phenetics vs. cladistics Lysozyme amino acid changes in unrelated ruminants Phenetics vs. cladistics.

Slides:

Advertisements

Similar presentations

CS 598AGB What simulations can tell us. Questions that simulations cannot answer Simulations are on finite data. Some questions (e.g., whether a method.

Advertisements

Ortholog vs. paralog? 1. Collect Sequence Data Good Dataset

Phylogenetic Tree A Phylogeny (Phylogenetic tree) or Evolutionary tree represents the evolutionary relationships among a set of organisms or groups of.

Correlating traits with phylogenies Using BaTS. Phylogeny and trait values A phylogeny describes a hypothesis about the evolutionary relationship between.

Estimating the reliability of a tree Reconstructed phylogenetic trees are almost certainly wrong. They are estimates of the true tree. But how reliable.

Lecture 3 Molecular Evolution and Phylogeny. Facts on the molecular basis of life Every life forms is genome based Genomes evolves There are large numbers.

1 General Phylogenetics Points that will be covered in this presentation Tree TerminologyTree Terminology General Points About Phylogenetic TreesGeneral.

Phylogenetic Trees Understand the history and diversity of life. Systematics. –Study of biological diversity in evolutionary context. –Phylogeny is evolutionary.

Maximum Likelihood. Likelihood The likelihood is the probability of the data given the model.

Molecular Evolution Revised 29/12/06

BIOS E “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical.

BIOE 109 Summer 2009 Lecture 4- Part II Phylogenetic Inference.

“Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Tree of Life: primary divisions OEB 192 –

What can sequences tell us? BIOL E-127– 10/15/07.

OEB 192 – “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical.

Phylogeny. Reconstructing a phylogeny  The phylogenetic tree (phylogeny) describes the evolutionary relationships between the studied data  The data.

BIOE 109 Summer 2009 Lecture 6- Part II Molecular evolution.

Phylogenetic reconstruction

More on neutral theory OEB 192 – Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.

Dispersal models Continuous populations Isolation-by-distance Discrete populations Stepping-stone Island model.

OEB 192 – “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical.

Genetic exchange in bacteria/archaea OEB 192 –

Ln(7.9* ) –ln(6.2* ) is  2 – distributed with (n-2) degrees of freedom Output from Likelihood Method. Likelihood: 6.2*  = 0.34.

Probabilistic methods for phylogenetic trees (Part 2)

Phylogenetic Analysis. 2 Phylogenetic Analysis Overview Insight into evolutionary relationships Inferring or estimating these evolutionary relationships.

“Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Topic : Phylogenetic Reconstruction I. Systematics = Science of biological diversity. Systematics uses taxonomy to reflect phylogeny (evolutionary history).

Phylogeny Estimation: Traditional and Bayesian Approaches Molecular Evolution, 2003

Terminology of phylogenetic trees

Molecular phylogenetics

Christian M Zmasek, PhD 15 June 2010.

Molecular basis of evolution. Goal – to reconstruct the evolutionary history of all organisms in the form of phylogenetic trees. Classical approach: phylogenetic.

Chapter 26: Phylogeny and the Tree of Life Objectives 1.Identify how phylogenies show evolutionary relationships. 2.Phylogenies are inferred based homologies.

COMPUTATIONAL MODELS FOR PHYLOGENETIC ANALYSIS K. R. PARDASANI DEPTT OF APPLIED MATHEMATICS MAULANA AZAD NATIONAL INSTITUTE OF TECHNOLOGY (MANIT) BHOPAL.

Speciation history inferred from gene trees L. Lacey Knowles Department of Ecology and Evolutionary Biology University of Michigan, Ann Arbor MI

plants animals monera fungi protists protozoa invertebrates vertebrates mammals Five kingdom system (Haeckel, 1879)

Phylogenetic Analysis. General comments on phylogenetics Phylogenetics is the branch of biology that deals with evolutionary relatedness Uses some measure.

Phylogenetic trees School B&I TCD Bioinformatics May 2010.

Computational Biology, Part D Phylogenetic Trees Ramamoorthi Ravi/Robert F. Murphy Copyright  2000, All rights reserved.

Phylogenetics and Coalescence Lab 9 October 24, 2012.

Introduction to Phylogeny Cédric Notredame Centro de Regulacio Genomica Adapted from Aiden Budd’s Lecture on Phylogeny.

3- RIBOSOMAL RNA GENE RECONSTRUCITON  Phenetics Vs. Cladistics  Homology/Homoplasy/Orthology/Paralogy  Evolution Vs. Phylogeny  The relevance of the.

Bioinformatics 2011 Molecular Evolution Revised 29/12/06.

Introduction to Phylogenetic Trees

Announcements Urban Forestry project starts this week. Go through protocol. We'll be sending you off on your own. Please act responsibly. Peer review of.

Lecture 2: Principles of Phylogenetics

Introduction to Phylogenetics

Calculating branch lengths from distances. ABC A B C----- a b c.

Molecular Phylogeny. 2 Phylogeny is the inference of evolutionary relationships. Traditionally, phylogeny relied on the comparison of morphological features.

Lecture 17: Phylogenetics and Phylogeography

Phylogeny Ch. 7 & 8.

“Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Ayesha M.Khan Spring Phylogenetic Basics 2 One central field in biology is to infer the relation between species. Do they possess a common ancestor?

CS 395T: Computational phylogenetics January 18, 2006 Tandy Warnow.

Building Phylogenies Maximum Likelihood. Methods Distance-based Parsimony Maximum likelihood.

HW7: Evolutionarily conserved segments ENCODE region 009 (beta-globin locus) Multiple alignment of human, dog, and mouse 2 states: neutral (fast-evolving),

Phylogenetic trees. 2 Phylogeny is the inference of evolutionary relationships. Traditionally, phylogeny relied on the comparison of morphological features.

Phylogeny and the Tree of Life

Evolutionary genomics can now be applied beyond ‘model’ organisms

Phylogenetic basis of systematics

The neutral theory of molecular evolution

Phylogenetic Inference

Goals of Phylogenetic Analysis

Molecular basis of evolution.

Chapter 19 Molecular Phylogenetics

Phylogenetics Chapter 26.

Algorithms for Inferring the Tree of Life

But what if there is a large amount of homoplasy in the data?

Phylogenetic analysis of AquK2P.

Presentation transcript:

BIOS E-127 –

Phenetics vs. cladistics

Lysozyme amino acid changes in unrelated ruminants Phenetics vs. cladistics

Maximum Parsimony

Microbial systematics Formerly Pseudomonas (partial list): Ralstonia, Burkholderia, Hydrogenophaga, Sphingomonas, Methylobacterium, Cellvibrio, Xanthomonas, Acidovorax, Hydrogenophillus, Brevundimonas, Pandoraea

Molecular phylogenetics Zuckerkandl & Pauling Molecules as documents of evolutionary history. J Theor Biol. 8: Neutral theory (Motoo Kimura, 1968)

16S rRNA as phylogenetic marker Why a good molecule?

Good Dataset [A1, A2, A3, A4] [A1, B2, A3, A4] Bad Dataset A B species 1 species 2 species 3 species 4 A1 B1 A2 B2 A4 B4 A3 B3 Ortholog vs. paralog?

CGGATAAAC CGGATAGAC CGCGATAAAC CGGATAAC taxa1 taxa2 taxa3 taxa4 Alignment

Example: Neighbor Joining (NJ) Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA Species C TTCACTAGACCTGTGGTCCA Species D TTGACCAGACCTGTGGTCCG Species E TTGACCAGTTCTCTAGTTCG A B C D E Choose methods: distance-based A B C D E Species A Species B Species C Species D Species E ---- A B C D E Species A Species B Species C Species D Species E M(AB)=d(AB) -[(r(A) + r(B))/(N-2)]

Ancestral Sequences Observed Sequences ? Model Choose “model”

Maximum Parsimony (MP): Model: Evolution goes through the least number of changes Maximum Likelihood (ML): L (data| model) Bayesian Inference Markov chain Monte Carlo (MCMC) method for sampling from posterior probability distribution Discrete character methods

I. Bootstrap Re-sampling to produce pseudo-dataset (random weighting) II. Jacknife Sampling with replacement III. Permutation test Random deletion of sub-dataset Randomize dataset to build null likelihood distribution CGATCGTTA CAATGATAG CGCTGATAA CGCTGATCG taxa1 taxa2 taxa3 taxa Dataset1: Dataset2: … Dataset1: Dataset2: … Assess reliability

Reconstructed ancestral sequences to infer paleoenvironment (Gaucher et al., 2003)

Signs of selection (Sawyer & Malik, 2006)

5. Assess Reliability Molecular clock: HIV-1 origin (Korber et al., 2000)

Genetic exchange in bacteria/archaea

Detecting HGT from genomes: atypical nt composition (Hacker & Carniel, 2001)

Monday (10/6): Microbial species, biogeography & population genetics II.