From Extraction to Information DNA Sequencing From Extraction to Information I’m going to talk to you about the process of dna sequencing. So, that includes how we are able to take a biological sample, extract its dna, and then target a specific region of the dna molecule to determine its sequence. You’ve already extracted dna from coral bacteria and amplified its 16s gene. So I’m going to recap these processes that you’ve already done, then take you through the process that actually determines the sequence of the gene.

The Process Step 1: DNA Extraction Step 2: PCR Amplification Genomic DNA extraction from the organism (bacteria) Step 2: PCR Amplification Amplification of the DNA segment of interest (16S gene) Step 3: DNA Sequencing Sequencing of the PCR product (amplified 16S gene) The process of sequencing a gene can be broken down into 3 general steps: First step is to extract the genomic dna from the organism. 2nd step is to make more copies of the dna segment you are interested in using pcr. The final step is to use the amplified dna product to determine the sequence of the gene.

Step 1: DNA Extraction DNA Cells DNA Extraction with DNA So here are your bacteria cells with the dna in them. And the goal of dna extraction is to remove the complete genome from the cell. DNA Cells with DNA

Step 2: PCR Amplification Target Gene PCR Product (Amplified Target Gene) Target Gene PCR Amplification Then once you have the dna molecule isolated, You want to find the specific region you are interested in, called the target gene And make many copies of it. DNA

Step 3: DNA Sequencing PCR product Sequence of Target Gene (Amplified Target Gene) Sequence of Target Gene DNA Sequencing AGCTGCTAAGCTTG AGCTTGCACAAGCT TAGCTTGCAAGCTT AGCTTGCAAGCTTG CAAGCTTGCAAGCT TGCAAGCTTGCAAG CTTGCAACGTTGCA AAGCTTGCAAGCTA Once you have generated enough copies of your gene, You an take it through the sequencing process to determine its exact sequence.

Chapter 1: DNA Extraction Now lets go into more detail for each of the steps.

The Cell and its Components DNA (1%) phospholipids (2%) 30% chemicals polysaccharides (2%) Ions, small molecules (4%) RNA (6%) 70% H2O Here is your bacteria cell: Made up of mostly water and 30% biochemicals like protein etc, notice dna is present in the smallest amount proteins (15%)

Three basic steps of DNA extraction Disruption of cell and lysis Removal of proteins and other biochemicals Recovery of DNA So to isolate the dna from the cell you have to rupture the cell membrane Take away all of the other biochemicals in the cell (like protiens, etc.) While still retaining high quality dna.

Disruption of cell and lysis Cells are broken down into components using a Lysis Buffer containing: EDTA: disrupts cell membrane and inhibits DNases SDS: denatures proteins and solubilizes cell membranes Proteinase K: breaks down proteins RNase A: breaks down RNA Solution is incubated at 55ºC 1-3 hours (or overnight) To do this we incubate the cells in a lysis buffer that contains among other things edta, sds, prok, and rnase a. Each of these chemicals plays a very important function as we’ll see more clearly in the next slide. This solution is incubated at 55degrees for 1-3 hours or overnight.

Disruption of cell and lysis DNA RNA proteins lipids ions + Here is the bacterial cell. The edta and sds will help to rupture the cell membrane causing everything to spill out. We want to get rid of everything but the dna since these biochemicals will inhibit the pcr process, so the rnase a, pro k, sds will chop up the large molecules and the edta will bind to the free ions which will prevent any enzymes from digesting the dna. This will ensure we will retain high-quality dna + + + EDTA RNase A Proteinase K SDS EDTA

Disruption of cell and lysis After lysis, cell extract contains DNA, proteins, and other chemicals/biochemicals cell extract

Removal of proteins and biochemicals Solid phase binding (silica membrane) Cell extract is applied to a silica membrane column DNA binds to membrane all other molecules flow through and are removed DNA bound to membrane The simplest way to remove the other biochemicals is to use a purification kit that employs solid phase binding. Cell extract is applied to the membrane in the column. The dna binds to the membrane and all other molecules are rinsed away. Silica membrane centrifugation cell extract flow-thru

Recovery of DNA Elution of silica membrane: a low-salt buffer or water is added to the membrane bound DNA falls off of the membrane elution add water (or buffer) DNA bound to membrane To recover the dna, a low salt buffer or water is added to the membrane Spun down And the dna is recovered in solution. centrifugation DNA in solution

Review Step 1: DNA Extraction So to recap: We extract the DNA through: -disruption and lysis of the cell -removal of proteins and other biochemicals -recovery of DNA using silica-membrane binding DNA Cells with DNA

Chapter 2: PCR Amplification Now that we have isolated the dna from the cell, we want to find our target gene and amplify it.

Step 2: PCR Amplification Target Gene PCR Product (Amplified Target Gene) Target Gene PCR Amplification Here again is the basic game plan of pcr-amplification step of the sequencing process. DNA

Part I: DNA Polymerization to Fully understand how the amplification step works, Let’s review what it means to copy and synthesize dna.

DNA Building Block base P P P OCH2 O sugar H H OH H 5’ OCH2 O sugar 4’ 1’ H phoshpate groups H 3’ 2’ OH H This is a nucleotide or the building block of the dna molecule. It comes in four different types: a,c,g,t depending on the base. The order of these nucleotides is what makes up the sequence of a gene. deoxyribose nucleotide triphosphate (dNTP)

DNA Polymerization: Basics Existing DNA Strand O P O G O P O C O P O T Phosphodiester bond O H dNTP P P P O T Here is a general look at what happens when a dna molecule is being synthesized: There is an existing dna strand Then an unbound dntp is added to the strand by a phosphodiester bond at the 3 prime place on the sugar ring. Two of the phospate groups will fall away and the remaining one will form the link between the two sugar molecules O H P P P O A O H P P P O C O H

DNA Polymerization The synthesis of DNA requires: DNA template Primer: short oligonucleotide necessary for DNA polymerase to start DNA polymerase: enzyme that constructs the DNA chain deoxyribonucleotide triphosphates (dNTPs): building blocks of DNA A C C G G G A A G C C C C G G A T G A DNA polymerase A C So this is what is required for that polymerization to occur: A dna template that acts as a guideline for the order that the dntps will be added in. G T DNA polymerase G A T G A G T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G G G C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G

DNA Replication Review Step 1: Denaturation: separation of the two strands of the DNA duplex Gyrase pulls apart the strands creating a “replication bubble” Helicase travels down DNA molecule, breaking the hydrogen bonds that hold the two strands together So this is what actually takes place in a cell when dna molecules need to be synthesized. Two enzymes denature or separate the two complementary strands of the dna molecule. Gyrase pulls apart the strands, then helicase travels down the dna molecule , breaking the hydrogen bonds that held the molecule together helicase gyrase helicase G A T G A G T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G G G C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G gyrase

DNA Replication Review Step 2: Annealing of primers to the DNA template strand Primase synthesizes small complementary strands of RNA (“primers”) to the single strands of the DNA template Next an enzyme called primase makes short complementary strands of rna to the single strands of dna template. We can call these primers. primase G A T G A G T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G G G C G C C C C G primase G A T G A G C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G

DNA Replication Review Step 3: Extension of newly constructed complementary DNA molecules DNA polymerase adds bases to the ends of the primers, constructing an exact copy of the template Dna polymerase adds new dntps to the ends of the primers based on the specific binding of the bases to each other. A can only pair with t and c only with g. Therefore it is able to create an exact copy of the template strand. DNA polymerase G A T G A G T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G G G C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G DNA polymerase G A T G A G T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G G G C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G

DNA Replication Review Another DNA Polymerase replaces the RNA primer with dNTPs The final result: two copies of replicated DNA DNA polymerase G A T G A G T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G G G C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G G C C C C C C C C G G DNA polymerase G G A A T T G G A A G G T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G G G C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G

Polymerization Mg2+ ions dNTPs DNA Polymerase Primer DNA Template C O P G O P T O P T O P C O P G O P A O P Mg2+ ions 4) dNTPs dNTPs 5) Mg2+ ions DNA Polymerase Primer DNA Polymerase Phosphodiester bond A O P T G C Here’s a more detailed look at the process of dna synthesis. Here is a structure of a dna template. And a structure of the primer. Notice the a-t and g-c pairings. The dna polymerase attaches to the end of the primer and adds the appropriate dntps to the primer based on the template strand and with the help of magnesium, attaches them using phosphodiester bonds T P O C G A DNA Template

Part II: PCR Now that we’ve reviewed dna polymerization within a cell, lets see how it compares to polymerization using synthetic means, otherwise known as the polymerase chain reaction.

The Polymerase Chain Reaction Polymerase Chain Reaction: cycling process consisting of the same 3 steps of DNA replication, with some differences: temperature cycling removes the need for other enzymes (gyrase/helicase, or primase) PCR uses pre-made oligonucleotide DNA primers DNA polymerase gyrase primase T C A G helicase T A G C

The Polymerase Chain Reaction During PCR, a thermocycler brings the reaction mix to 3 different temperatures analagous to the 3 steps of DNA replication Denaturation (94˚C) of the DNA template by heat Annealing (37˚-70˚C) of the primers to the template Extension (72˚C) of the DNA strand by DNA polymerase These steps are repeated for 25 to 30 cycles 94˚C 65˚C 72˚C denaturation annealing extension

Thermocycler Program Initial Denaturation: 94˚C 2 min Start Cycle Denaturation 94˚C 30 sec Annealing 65˚C 30 sec Extension 72˚C 30 sec Repeat Cycle 29 times (total = 30 cycles) Final Extension 72˚C 7 min Hold 4˚C ∞

Denaturation Denaturation occurs at 94˚C The high temperature is used to break down the hydrogen bonds that hold the two strands together 94˚C G A T G A G T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G G G C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G

Annealing Annealing occurs at 37˚-70˚C 94˚C 65˚C Oligonuclotide DNA primers anneal to their complementary sequences on the template strands Annealing temperature depends on the melting temperature (Tm) of the primer (dependent on base composition) 94˚C 65˚C G A T G A G T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G G G C T A G C T C A G C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G

Extension Extension occurs at 72˚C DNA polymerase attaches to the primers and extends the new DNA strand The 3 steps (denaturation, annealing, and extension) are repeated for another 24 to 29 cycles 65˚C 72˚C DNA polymerase G A T G A G T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G G G C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C DNA polymerase T C A G T A C A A C T G G C G T A A T C A T G G C C C T T C G G G G C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G

Target Sequence A desired target sequence is identified To isolate the target sequence, primers that flank the region must be constructed The DNA segment that is then amplified contains the region of interest Template DNA Forward Primer Reverse Primer Target Sequence of interest PCR Product

PCR: Cycle 1 Annealing Denaturation Extension 4 DNA Copies 4 Target Copies Target Sequence of interest

PCR: Cycle 2 Annealing Denaturation Extension 8 2 DNA Copies Target Copies 2

PCR: Cycle 3 Annealing Denaturation Extension 16 8 DNA Copies Target Copies 8

PCR: Cycle 4 Annealing Extension Denaturation 32 22 DNA Copies Target Copies 22

PCR: Cycle 5 Annealing Extension Denaturation 64 52 DNA Copies Target Copies 52

PCR Amplification: First 10 cycles

PCR Amplification: First 15 cycles

PCR Amplification: After 30 cycles

PCR Amplification: After 30 cycles Target Copies 1   16 65,504 2 17 131,038 3 18 262,108 4 8 19 524,250 5 22 20 1,048,536 6 52 21 2,097,110 7 114 4,194,260 240 23 8,388,562 9 494 24 16,777,168 10 1,004 25 33,554,382 11 2,026 26 67,108,812 12 4,072 27 134,217,674 13 8,166 28 268,435,400 14 16,356 29 536,870,854 15 32,738 30 1,073,741,764

Review Step 1: DNA Extraction Cells with DNA

Review Step 2: PCR Amplification Target Gene PCR Product (Amplified Target Gene) Target Gene PCR Amplification DNA

Chapter 3: DNA Sequencing

deoxyribose NTP (dNTP) Nucleotides BASE BASE P P P OCH2 P P P OCH2 O O H H H H OH H OH OH ribose NTP (NTP) (Makes up RNA) deoxyribose NTP (dNTP) (Makes up DNA) These are the different nucleotides often seen in molecular biology. BASE P P P OCH2 O H H H H dideoxyribose NTP (ddNTP)

DNA Sequencing Dideoxy method of DNA sequencing (Sanger Method) Single-stranded DNA to be sequenced serves as a template strand for DNA synthesis single primer is used for DNA synthesis initiation use of dNTPs along with labeled ddNTPs BASE BASE P P P OCH2 P P P OCH2 O O H H H H OH H H H dNTP ddNTP

DNA Polymerization using ddNTPs C P O C O O P O T P O C O H O H P P P O T P P P O T O H H P P P O A P P P O A O H O H P P P O C Chain Termination O H

Sequence Reaction BigDye Terminator v3.1 Sequencing: a Dye Terminator Cycle Sequencing Master Mix is used for sequencing reaction. Components include: DNA polymerase I, Mg2+, buffer dNTPs in ample quantities: (dATP, dTTP, dCTP, dGTP) ddNTPs in limited quantities, each labeled with a “tag” that fluoresces a different “color”: (ddATP, ddTTP, ddCTP, ddGTP)

The Polymerase Chain Reaction PCR makes use of a thermocycler to bring the reaction mix to three different temperatures Denaturation (94˚C) of the DNA template by heat Annealing (37˚-70˚C) of the primers to the template Extension (72˚C) of the DNA strand by DNA polymerase These steps are repeated for 25 to 30 cycles 94˚C 65˚C 72˚C denaturation annealing extension

Sequencing Reaction Sequencing reaction is a cycled reaction using a thermocycler (as in the Polymerase Chain Reaction) Like PCR, it consists of 3 steps: Denaturation, Annealing, Extension; these 3 steps are repeated for 30 cycles Unlike PCR, it involves a single primer and labeled ddNTPs extension proceeds normally until, by chance, DNA polymerase inserts a ddNTP, terminating the chain

Sequencing Reaction G A A C T C G G G T T T G G G T T T C C C C C C G DNA polymerase G A A C T C G G G T T T G G G T T T C C C C C C G G G T T T A A A C C C A A A A A A C C C T T T G G G G G G C C C G G G T T A A A A T T C A T G G C C C T T C G C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G

Sequencing Reaction G T G T C C G T A C A A C T G G C G T A A T C A T DNA polymerase G A A C T C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G

Sequencing Reaction G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C G T G T C C G T A C A A C T G G C G T A A T C A T G G C G T G T C C G T A C A A C T G G C G T A A T C A T G G G T G T C C G T A C A A C T G G C G T A A T C A T G G T G T C C G T A C A A C T G G C G T A A T C A T G T G T C C G T A C A A C T G G C G T A A T C A G T G T C C G T A C A A C T G G C G T A A T C So when we line up the various fragments according to size, we can start to see how we will be able to see the order of the bases within our target gene. G T G T C C G T A C A A C T G G C G T A A T G T G T C C G T A C A A C T G G C G T A A G T G T C C G T A C A A C T G G C G T A G T G T C C G T A C A A C T G G C G T G T G T C C G T A C A A C T G G C G DNA polymerase G A A C T C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G

Applied Biosystems 3130xl Genetic Analyzer 16-channel capillary electrophoresis capable of various genomic analysis functions The machine able to detect the fluorescent ddntps and assort the reaction fragments according to size is called the 3130xl genetic analyzer.

Capillary Electrophoresis the sequencing reactions are loaded into the ABI3130xl Samples are taken up by capillaries containing polyacrylamide gel (Performance Optimized Polymer (POP-7) Fragments are separated by length from shortest to longest by electrophoresis Detector In this machine each sequencing reaction is loaded into its own well. And one capillary is designeated for each well. The sample is taken up into the capillary that is filled with a polyacrylamide gel. And the fragments are separated by length from shortest to longest by electrophoresis - + Capillary array Laser Samples

Electrophoresis Electrophoresis is a technique used to separate DNA or protein molecules on the basis of size and charge Typical method used for analyzing, identifying and purifying DNA fragments

Movement in an Electric Field The mobility of molecules in the electrical field is also affected by their overall size or molecular weight Lower Molecular weight Higher Molecular weight – Agarose gel +

DNA Gel Electrophoresis These “markers” are run alongside samples, Helps determine the length of the PCR sample DNA fragments of the same length will migrate through the gel at the same rate 1500bp 1200bp 1100bp 1000bp 900bp 1050bp 800bp 820bp 700bp 600bp 650bp 500bp 400bp 400bp 300bp 200bp 280bp 100bp

Electrophoresis - As the sample travels through the capillaries + Shorter fragments have less resistance and migrate faster Longer fragments have more resistance and move slower So using this same principle, the shorter reaction fragments will move quicker than the longer fragments and the fragments will assort themselves according to size. - +

Fluorescense detection As fragments pass through detector window, the fluorescent “tag” of the ddNTP is excited by a laser The emission of the “tag” is picked up by a detector and is translated to a colored peak unique to the nucleotide A G C T

Sequencing Reaction G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G T G T C C G T A C A A C T G G C G G T G T C C G T A C A A C T G G C G T A A T G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T G T G T C C G T A C A A C T G G C G T G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T G T G T C C G T A C A A C T G G C G T A A T C A G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C G T G T C C G T A C A A C T G G C G T A A T C G T G T C C G T A C A A C T G G C G T A A T C A T G G G T G T C C G T A C A A C T G G C G T A G T G T C C G T A C A A C T G G C G T A A T C A T G G C So you take your sequencing reaction with its varied fragment lengths G T G T C C G T A C A A C T G G C G T A A G T G T C C G T A C A A C T G G C G T A A T C A T G G C C G T G T C C G T A C A A C T G G C G T A A T C A T G T G T C C G T A C A A C T G G C G T A A T C A T G DNA polymerase G A A C T C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G

Capillary Electrophoresis As the sample travels through the capillaries Shorter fragments have less resistance and migrate faster Longer fragments have more resistance and move slower You pass them through an electrical field in the capillary where they will assort themselves according to size, shorter fragments first. - +

Detection of fluorescent tags Then the fragments will pass through the detection window in the machine in order of size, and the fluorescence of the ddntps will be recorded in the computer software.

Final Data The final data generated is the complete chromatogram and the text version of the DNA sequence And in the software, the final data is generated as this image called a chromatogram as well as a text version. ACAACTGGCGTGAATCATGGCCCTTCGGGGCCATTGTTTCTCTGTGGAGGAGTGCCATGACGAAAGATGAACTGATTGCCCGTCTCCGCTCGCTGGGTGAACAACTGAACCGTGATGTCAGCCTGACGGGGACGAAAGAAGAACTGGCGCTCCGTGTGGCAGAGCTGAAAGAGGAGCTTGATGACACGGATGAAACTGCCGGTCAGGACACCCCTCTCAGCCGGGAAAATGT

Review Step 1: DNA Extraction Cells with DNA

Review Step 2: PCR Amplification Target Gene PCR Product (Amplified Target Gene) Target Gene PCR Amplification DNA

Review Step 3: DNA Sequencing PCR product (Amplified Target Gene) Sequence of Target Gene DNA Sequencing AGCTGCTAAGCTTG AGCTTGCACAAGCT TAGCTTGCAAGCTT AGCTTGCAAGCTTG CAAGCTTGCAAGCT TGCAAGCTTGCAAG CTTGCAACGTTGCA AAGCTTGCAAGCTA

BWET.PL4.8F Sequence

BWET.PL4.8F Sequence GCAGTCGAGCGGAACGAGTTATCTGAACCTTCGGGGAACGATAACGGCGTCGAGCGGCGGACGGGTGAGTAATGCCTGGGAAATTGCCCTGATGTGGGGGATAACCATTGGAAACGATGGCTAATACCGCATAATAGCTTCGGCTCAAAGAGGGGGACCTTCGGGCCTCTCGCGTCAGGATATGCCCAGGTGGGATTAGCTAGTTGGTGAGGTAAGGGCTCACCAAGGCGACGATCCCTAGCTGGTCTGAGAGGATGATCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCAGTGAGGAAGGTGGTGATGTTAATAGCATCATCATTTGACGTTAGCTGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCCG

BLAST BLAST: Basic Local Alignment Search Tool www.ncbi.nlm.nih.gov/blast an unknown sequence can be matched up to known sequences published in GenBank Lists all sequences producing significant alignments Gene identification Organism genus/species % identity alignment/match

BLAST Results of BWET.PL4.8F

BLAST Results of BWET.PL4.8F Summary of best match: Vibrio sp. BISLTS1 16S ribosomal RNA gene Identities = 435/436 (99%) Vibrio is a genus of gram-negative bacteria. Typically found in salt water and are facultative anaerobes Several spp cause human disease such as gastroenteritis and septicemia. Been known to cause fatal infections in humans and marine life.

The End