Human population migrations Out of Africa, Replacement –Single mother of all humans (Eve) ~150,000yr –Single father of all humans (Adam) ~70,000yr –Humans.

Slides:



Advertisements
Similar presentations
Multiple Comparisons Measures of LD Jess Paulus, ScD January 29, 2013.
Advertisements

Joint Linkage and Linkage Disequilibrium Mapping
Understanding GWAS Chip Design – Linkage Disequilibrium and HapMap Peter Castaldi January 29, 2013.
1) Linkage means A) Alleles at different loci are independent B) Alleles at different loci are physically close to each other and on the same chromosome.
Association Mapping David Evans. Outline Definitions / Terminology What is (genetic) association? How do we test for association? When to use association.
Plant of the day! Pebble plants, Lithops, dwarf xerophytes Aizoaceae
Atelier INSERM – La Londe Les Maures – Mai 2004
Signatures of Selection
Genomics An introduction. Aims of genomics I Establishing integrated databases – being far from merely a storage Linking genomic and expressed gene sequences.
CS177 Lecture 9 SNPs and Human Genetic Variation Tom Madej
DNA Sequencing. CS273a Lecture 3, Spring 07, Batzoglou DNA sequencing How we obtain the sequence of nucleotides of a species …ACGTGACTGAGGACCGTG CGACTGAGACTGACTGGGT.
Picking SNPs Application to Association Studies Dana Crawford, PhD SeattleSNPs PGA University of Washington March 20, 2006.
Human Migrations Saeed Hassanpour Spring Introduction Population Genetics Co-evolution of genes with language and cultural. Human evolution: genetics,
BIOE 109 Summer 2009 Lecture 13- Part II Human evolution.
Conditional Random Fields 1 2 K … 1 2 K … 1 2 K … … … … 1 2 K … x1x1 x2x2 x3x3 xKxK 2 1 K 2.
Inferring Haplotypes Dr. Russell Thomson. A Haplotype. …AGCTATATTA…..GGCTGCTC…..AGCAGCGA… …AGCTAAATTA…..GGCTCCTC…..AGCAGCGA… One individual. Marker 1Marker.
CS273a Lecture 1, Autumn 10, Batzoglou DNA Sequencing.
DNA Sequencing. CS273a Lecture 3, Autumn 08, Batzoglou DNA sequencing How we obtain the sequence of nucleotides of a species …ACGTGACTGAGGACCGTG CGACTGAGACTGACTGGGT.
Human population migrations Out of Africa, Replacement –Single mother of all humans (Eve) ~150,000yr –Single father of all humans (Adam) ~70,000yr –Humans.
SNP Selection University of Louisville Center for Genetics and Molecular Medicine January 10, 2008 Dana Crawford, PhD Vanderbilt University Center for.
Welcome to CS374! A survey of computer science in genomics today ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG.
How old am I? Office Hours Bonuses. 1.7 million-year-old human ancestor.
Introduction Basic Genetic Mechanisms Eukaryotic Gene Regulation The Human Genome Project Test 1 Genome I - Genes Genome II – Repetitive DNA Genome III.
Answer key posted on the class webpage
MECHANISMS FOR EVOLUTION Honors Biology. REVIEW Evidence for Evolution and Examples What is Natural Selection? How did Darwin develop theory of Natural.
Haplotype Blocks An Overview A. Polanski Department of Statistics Rice University.
The medical relevance of genome variability Gabor T. Marth, D.Sc. Department of Biology, Boston College
Genetic Variations Lakshmi K Matukumalli. Human – Mouse Comparison.
SNPs Daniel Fernandez Alejandro Quiroz Zárate. A SNP is defined as a single base change in a DNA sequence that occurs in a significant proportion (more.
Conservation of genomic segments (haplotypes): The “HapMap” n In populations, it appears the the linear order of alleles (“haplotype”) is conserved in.
CS177 Lecture 10 SNPs and Human Genetic Variation
SNPs and the Human Genome Prof. Sorin Istrail. A SNP is a position in a genome at which two or more different bases occur in the population, each with.
Informative SNP Selection Based on Multiple Linear Regression
Human Population Genomics ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG.
Population Genetics Chapter 13 – Part 2. Selection: Two Kinds There are two types of selection: Natural Selection Artificial selection.
10cM - Linkage Mapping Set v2 ABI Median intermarker distance: 4.7 Mb Mean intermarker distance: 5.6 Mb Mean genetic gap distance: 8.9 cM Average Heterozygosity.
Introduction: Human Population Genomics ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG.
Introduction: Human Population Genomics ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG.
Models of Molecular Evolution III Level 3 Molecular Evolution and Bioinformatics Jim Provan Page and Holmes: Sections 7.5 – 7.8.
Genes in human populations n Population genetics: focus on allele frequencies (the “gene pool” = all the gametes in a big pot!) n Hardy-Weinberg calculations.
Human Population Genomics ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG.
Linear Reduction Method for Tag SNPs Selection Jingwu He Alex Zelikovsky.
SNPs, Haplotypes, Disease Associations Algorithmic Foundations of Computational Biology II Course 1 Prof. Sorin Istrail.
1 Balanced Translocation detected by FISH. 2 Red- Chrom. 5 probe Green- Chrom. 8 probe.
The International Consortium. The International HapMap Project.
11.3 Other Mechanisms of Evolution KEY CONCEPT Natural selection is not the only mechanism through which populations evolve.
Copyright © 2010 Pearson Education, Inc. publishing as Benjamin Cummings Lectures by Greg Podgorski, Utah State University Current Issues in Biology, Volume.
Linkage Disequilibrium and Recent Studies of Haplotypes and SNPs
11.3 Other Mechanisms of Evolution KEY CONCEPT Natural selection is not the only mechanism through which populations evolve.
Our Current Understanding of Human Demographic History and Migrations NeandertalModern Homo Sapiens.
0kf8mhS4&feature=related.
The Debate over Modern Human Origins  What have been the major competing models regarding the origin of modern Homo sapiens?  What evidence has been.
Inferences on human demographic history using computational Population Genetic models Gabor T. Marth Department of Biology Boston College Chestnut Hill,
Evolution and Population Genetics
Genetic Linkage.
Of Sea Urchins, Birds and Men
Population Genetics As we all have an interest in genomic epidemiology we are likely all either in the process of sampling and ananlysising genetic data.
Genetic Engineering in Medicine, Agriculture, and Law
Genetic Linkage.
Recombination (Crossing Over)
Linkage: Statistically, genes act like beads on a string
Unit 8 – Evolution Learning Activities
EVIDENCE FOR EVOLUTION
Genetic Drift, followed by selection can cause linkage disequilibrium
Genetic Linkage.
Gene Discovery for Complex Traits: Lessons from Africa
Genome-Wide Association Studies: Present Status and Future Directions
Bonus #1 is due today at 5pm by
February 13th A change in the DNA sequence is known as a___? How can this lead to evolution of a population? The mixing up of DNA in meiosis, which can.
Nature Genetics, Supplement, November 2004
Presentation transcript:

Human population migrations Out of Africa, Replacement –Single mother of all humans (Eve) ~150,000yr –Single father of all humans (Adam) ~70,000yr –Humans out of Africa ~40000 years ago replaced others (e.g., Neandertals) –Evidence: mtDNA, Y chromosome Multiregional Evolution –Fossil records show a continuous change of morphological features –Proponents of the theory doubt mtDNA and other genetic evidence

Why humans are so similar A small population that interbred reduced the genetic variation Out of Africa ~ 40,000 years ago Out of Africa

Migration of Humans

Migration of Humans

Human Variation in the Y Chromosome

Some Key Definitions Mary: AGCCCGTACG John: AGCCCGTACG Josh: AGCCCGTACG Kate: AGCCCGTACG Pete: AGCCCGTACG Anne: AGCCCGTACG Mimi: AGCCCGTACG Mike: AGCCCTTACG Olga: AGCCCTTACG Tony: AGCCCTTACG Mary: AGCCCGTACG John: AGCCCGTACG Josh: AGCCCGTACG Kate: AGCCCGTACG Pete: AGCCCGTACG Anne: AGCCCGTACG Mimi: AGCCCGTACG Mike: AGCCCTTACG Olga: AGCCCTTACG Tony: AGCCCTTACG Alleles: G, T Major Allele: G Minor Allele: T G/G G/T G/G T/T T/G G/G G/T G/G T/T T/G Recombinations: At least 1/chromosome On average ~1/100 Mb Linkage Disequilibrium: The degree of correlation between two SNP locations MomDad

The Fall in Heterozygosity

The HapMap Project

The HapMap Project – Haplotype Blocks

The HapMap Project – LD

Fixation, Positive & Negative Selection Neutral Drift Positive Selection Negative Selection How can we detect negative selection? How can we detect positive selection?